View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17324_high_14 (Length: 219)
Name: NF17324_high_14
Description: NF17324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17324_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 29114298 - 29114112
Alignment:
| Q |
18 |
agaaaatgtgttttttacgggacacttgtctgagttgtccgacacacgtcataagagttccatacaagtgttggacactctgacatgcctgattcaaaag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29114298 |
agaaaatgtgttttttacgggacacttgtctgagttgtccgacacacgtcataagagttccatacaagtgttggacactatgacatgcctgattcaaaag |
29114199 |
T |
 |
| Q |
118 |
gtgtccgtgcttcattgggaagtacgtttgagactatttgagacagcttatagagacaactcatgacatgtgcataaactctctgtg |
204 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
29114198 |
gtgtccgtgcttcataggtaagtacgtttgagactatttgagacagcttatagagacaactcatcacatgtccataaactctctgtg |
29114112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 146 - 194
Target Start/End: Original strand, 1741997 - 1742045
Alignment:
| Q |
146 |
tgagactatttgagacagcttatagagacaactcatgacatgtgcataa |
194 |
Q |
| |
|
|||||||||||| || ||||||| || |||||| ||||||||||||||| |
|
|
| T |
1741997 |
tgagactatttgggagagcttatggaaacaacttatgacatgtgcataa |
1742045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University