View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17324_low_16 (Length: 241)
Name: NF17324_low_16
Description: NF17324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17324_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 36459899 - 36460112
Alignment:
| Q |
18 |
ttttattctaaatttcattcatttaccactctctgaattttgggtttactcatatgctttcaatctcagtttatcaatttggtatatacatggatgtgaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36459899 |
ttttattctaaatttcattcatttaccactctctgaattttcggtttactcatatgctttcaatctcagtttatcaatttggtatatacatggatgtgaa |
36459998 |
T |
|
| Q |
118 |
ttgagtctttgtggtgattttcatcattttgataaagtcaactctgcatgattgtaatcttaatcaccaattccgcttttgggtatttgaattcaatcta |
217 |
Q |
| |
|
||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36459999 |
ttgagtctttgaggtcattttcatcattttcataaagtcaactctgcatgattgtaatcttaatcaccaattccgcttttgggtatttgaattcaatcta |
36460098 |
T |
|
| Q |
218 |
tctaagtctctgtg |
231 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
36460099 |
tctaagtctttgtg |
36460112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University