View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17324_low_19 (Length: 209)
Name: NF17324_low_19
Description: NF17324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17324_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 6 - 191
Target Start/End: Original strand, 19451809 - 19451994
Alignment:
| Q |
6 |
acattcagagcggcttgaatatgtccagctctagcgtaaagatcaacaagacacccaaaatgcaccaaacttggttcaacattgtattccttagtcatca |
105 |
Q |
| |
|
||||| ||||| |||| ||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
19451809 |
acattgagagcctcttggatatgtccagctctagcataaagatcaacaagacatccataatgcaccaaacttggttcaacattgtactctttagtcatca |
19451908 |
T |
 |
| Q |
106 |
tttcaaaatacatcaacccttcatcaaccattccactatgattacatgcactcaacacaccaacaaaggtgatagaattcggcaca |
191 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19451909 |
tttcaaaatacattaacccttcatcaaccattccactatgattacatgcactcaacacaccaacaaaagtgatagaattcggcaca |
19451994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University