View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17324_low_9 (Length: 340)
Name: NF17324_low_9
Description: NF17324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17324_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 18 - 327
Target Start/End: Complemental strand, 33626292 - 33625980
Alignment:
| Q |
18 |
aatttgctaccaacattggtggcagtaacttgtgtatccatagagaatcctccaccagccattttctaaatactctatttttgtctatggat-----gat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33626292 |
aatttgctaccaacattggtggcagtaacttgtgtatccatagagaatcctccaccagccattttctaaatactctatttttgtctatggatcggatgat |
33626193 |
T |
|
| Q |
113 |
ctaaatgttcttaattttagaacaaaacttatttatgaatctcagaattaattagtttagctcgttgctggatcagcaactaatttataggataaggggt |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33626192 |
ctaaatgttcttaattatagaacaaaacttatttatgaatctcataattaattagtttagctcgttgctggatcagcaactaatttataggataaggggt |
33626093 |
T |
|
| Q |
213 |
tgcacttgcattgtcttttgctaattgggccaatgtgaatgaaatagactataggattaactatcttaattttttatatagaagaaagaatttgtcattc |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33626092 |
tgcacttgcattgtcttttgctaattgggccaatgtgaatgaaatagac--taggattaactatcttaattttttatatagaagaaagaatttgtcattc |
33625995 |
T |
|
| Q |
313 |
tattaggcagtattc |
327 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33625994 |
tattaggcagtattc |
33625980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University