View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17325_high_3 (Length: 434)
Name: NF17325_high_3
Description: NF17325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17325_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 1e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 44265693 - 44265535
Alignment:
| Q |
1 |
aagaggagaggcgacgattttaccaatgagagcgcaccgcatagtcatcatcacccctttgaattgaaatatcattttcaatgtctccctcttcctcttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| || ||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44265693 |
aagaggagaggcgacgattttaccaatgagagcacaccacagagtcatcatcatccctttgaattgaaatatcattttcaatgtctccctcttcttcttt |
44265594 |
T |
 |
| Q |
101 |
caccgtaagtt--ctctctttctct-----ttatgcaattcctaatttaatcaatgaat |
152 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
44265593 |
caccgtaagttccctctctttctctccatgttatgcaattcctactttaatcaatgaat |
44265535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 291 - 371
Target Start/End: Complemental strand, 44265469 - 44265389
Alignment:
| Q |
291 |
tgtttagccatcttggagagcttgtgaacatgtctcacaaacacctcatgaacaatgttcttaactgttttcataagttct |
371 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
44265469 |
tgtttagctatcttggagagcttgtgaacatgtctcacaaacaccttatgaacgatgtcattaactgttttcataagttct |
44265389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University