View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17325_high_7 (Length: 321)
Name: NF17325_high_7
Description: NF17325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17325_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 20 - 309
Target Start/End: Complemental strand, 35528988 - 35528699
Alignment:
| Q |
20 |
tcaatcacagctagttattgaatttttatgcatgtagtaaaatttatatacactgtataaaaattcctagatgctggtgatctcgttatccactatctca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35528988 |
tcaatcacagctagttattgaatttttatgcatgtagtaaaatttatatacactgtataaaaattcctagatgctggtgatctcgttatccactatctca |
35528889 |
T |
|
| Q |
120 |
ctgtagtgttttatggctggcttctactctccgctatttgggattcataaccaagttcttatgagacattgtattgccttctttactttggttgtcactt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35528888 |
ctgtagtgttttatggctggcttctactctccgctatttgggattcataaccaagttcttatgagacattgtattgccttctttactttggttgtcactt |
35528789 |
T |
|
| Q |
220 |
gtcaattctctttcttctaatgaagtcttctttagtttttcctcaaatgattgnnnnnnnatccttgaattaaatctgactatttatatt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
35528788 |
gtcaattctctttcttctaatgaagtcttctttagtttttcctcaaatgattgtttttttatcctttaattaaatctgactatttatatt |
35528699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University