View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17325_low_19 (Length: 277)
Name: NF17325_low_19
Description: NF17325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17325_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 6 - 263
Target Start/End: Original strand, 32913037 - 32913292
Alignment:
| Q |
6 |
tgagttgaaaaattacgattccatgccataattttttcatgcattcacatagtcacgacgttaatggctgtccggtcaagatcggacggttcagaaaaat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32913037 |
tgagttgaaaaattacgattccatgccataattttttcatgcattcacatagtcacgactttaatggctgtccggtcaagatcggacggttcagaaaaat |
32913136 |
T |
|
| Q |
106 |
cagatttaatttttctaaaaatacggaacttaaattatagtcatccgatcttgacgtgtgattgcatgtaagctaagcgtgacgatgatttataacttcg |
205 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32913137 |
cagatttaatttttctaaaaatacagaacttaaattatagtcatccgatcttgacgtgtgattgcatgtaagctaagtgtgacgatgatttataacttcg |
32913236 |
T |
|
| Q |
206 |
atctttgtaaagaaatattgtacactataaaatgttttcatgcaataattgcttccat |
263 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32913237 |
atctttgtaaagaaatattgtacactat--aatgttttcatgcaataattgcttccat |
32913292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University