View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17325_low_20 (Length: 265)
Name: NF17325_low_20
Description: NF17325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17325_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 10 - 260
Target Start/End: Complemental strand, 18505237 - 18504987
Alignment:
| Q |
10 |
ataatactataacataggaatactattacaagaggagtcatgtaccaaaatttggaagctgggattggaacgatcataataatttcccatacacaaactg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18505237 |
ataatactataacataggaatactattacaagaggagtcatgtaccaaaatttggaagctgggattggaacgatcataataatttcccatacacaaactg |
18505138 |
T |
|
| Q |
110 |
tttcgattccgcgacacaacccggttcactacgctatagttactcagctgagtctgaggatcgtgatctttatggtacagcagatttctacgacaaccat |
209 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18505137 |
tttcgattctgtgacacaacccggttcactacgctatagttactcagctgagtctgaggatcgtgatctttatggtacagcagatttctacgacaaccat |
18505038 |
T |
|
| Q |
210 |
gttgtctcatccaccatgctccttaatgttcctcgtaaaagggtatctcct |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18505037 |
gttgtctcatccaccatgctccttaatgttcctcgtaaaagggtatctcct |
18504987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University