View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17325_low_25 (Length: 220)
Name: NF17325_low_25
Description: NF17325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17325_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 20 - 203
Target Start/End: Complemental strand, 37139207 - 37139024
Alignment:
| Q |
20 |
gaataaataaccgaaacaaggattccagcagccttaagatccctcttaccaacaacaacagaatccattgttctatctttcacccatttcaattttatat |
119 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37139207 |
gaataaataactgaaacaaggattccagcagccttaagatccctcttaccaacaacaacagaatccattgttctatctttcacccatttcaattttatat |
37139108 |
T |
 |
| Q |
120 |
taaccaaactaaattcctgcaggtaaatatacccttgttgaacactatcaaggaaaccataatttcttgcagaactaaataaag |
203 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37139107 |
taaccaaactaaatttctgcaggtaaatatacccttgttgaacactatcaaggaaaccataatttcttgcagaactaaataaag |
37139024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University