View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17326_high_27 (Length: 318)
Name: NF17326_high_27
Description: NF17326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17326_high_27 |
 |  |
|
| [»] scaffold0036 (2 HSPs) |
 |  |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
| [»] scaffold0332 (1 HSPs) |
 |  |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold0242 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0116 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 3e-88; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 34856696 - 34856880
Alignment:
| Q |
1 |
tgttgaaccggtccggttttataaactggccgattcaccggtttttaccgatttccgccgagccacgccggtttacaccggtttgattgcatggccgatc |
100 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34856696 |
tgttgaaccggtccggttttgtaaaccggccgattcaccggtttttaccggtttccgccgagccacgccggtttacaccggtttgattgcatggccgatc |
34856795 |
T |
 |
| Q |
101 |
caataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34856796 |
caataaatagatcgaaccggacaccccaccggttcatggtccgatcggttcaaccggccggtccgagccggttttaaaaactatg |
34856880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 120 - 184
Target Start/End: Complemental strand, 281030 - 280966
Alignment:
| Q |
120 |
gacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactat |
184 |
Q |
| |
|
||||| ||||||||||| | | ||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
281030 |
gacacaccaccggttcacgattcgaccggcccaaccggccggtccgagccggtttttaaaactat |
280966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 71 - 185
Target Start/End: Complemental strand, 8260355 - 8260241
Alignment:
| Q |
71 |
gtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccg |
170 |
Q |
| |
|
|||| ||||||||| | ||||| |||||||||||| ||| |||||| ||||||| |||||||| ||| |||||| | |||||||| ||| ||||| |
|
|
| T |
8260355 |
gttttcaccggtttaactgcatagccgatccaatatgcagaccgaaccggacaccctaccggttctcggttgaaccggtccgaccggccgatccaagccg |
8260256 |
T |
 |
| Q |
171 |
gttttaaaaactatg |
185 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
8260255 |
gtttttaaaactatg |
8260241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 71 - 165
Target Start/End: Original strand, 21071322 - 21071416
Alignment:
| Q |
71 |
gtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccg |
165 |
Q |
| |
|
|||||||||||| | || ||||||||||||||| |||| | ||||| |||||||||| |||| |||||||||||||| || |||||| |||| |
|
|
| T |
21071322 |
gtttacaccggtctaatcacatggccgatccaatgaataacttgaaccggacaccccactagttcgtggtccgaccggttgaatcggccgatccg |
21071416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 113 - 185
Target Start/End: Original strand, 25768609 - 25768681
Alignment:
| Q |
113 |
cgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||||| |||||||||||||| ||| || |||| | |||| ||||| |||||||||||| ||||||||| |
|
|
| T |
25768609 |
cgaaccagataccccaccggttcacggttggatcggtccgaccgaccggttcgagccggttttcaaaactatg |
25768681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 58 - 185
Target Start/End: Original strand, 55676117 - 55676244
Alignment:
| Q |
58 |
ccgagccacgccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccgg |
157 |
Q |
| |
|
|||||||| |||||||| ||||||| |||||||| | |||| ||||| || | ||||| || || ||||||||| | ||||| |||||| ||||| |
|
|
| T |
55676117 |
ccgagccaagccggttttaaccggttcaattgcatgactgatctgataaacagcttgaaccggatacaccaccggtttacggtccaaccggtcggaccgg |
55676216 |
T |
 |
| Q |
158 |
ccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||||| ||| ||| ||||||||| |
|
|
| T |
55676217 |
ccggtccgagtcgggtttcaaaactatg |
55676244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 154; Significance: 1e-81; HSPs: 16)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 20623916 - 20624101
Alignment:
| Q |
1 |
tgttgaaccggtccggttttataaactggccgattcaccggtttttaccgatttccgccgagccacgccggtttacaccggtttgattgcatggccgatc |
100 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
20623916 |
tgttgaaccggtccggttttgtaaaccggccgattcaccggtttttaccggtttccgccgagccatgtcggtttacaccggtttgattgcatggccgatc |
20624015 |
T |
 |
| Q |
101 |
caataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatgg |
186 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20624016 |
caataaatagattgaaccggacaccccaccggttcatggtccgaccggttcaaccggccggtccgatccggttttaaaaactatgg |
20624101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 60 - 177
Target Start/End: Complemental strand, 12904452 - 12904336
Alignment:
| Q |
60 |
gagccacgccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggcc |
159 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | || ||||| | |||| |||||| ||||| |
|
|
| T |
12904452 |
gagccacgtcggtttacaccggtttgattgcatggccgatccaataaatagatcgaactagacaccctatcgcttcat-gaacgactagttcaatcggcc |
12904354 |
T |
 |
| Q |
160 |
ggtccgagccggttttaa |
177 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
12904353 |
ggttcgagccggttttaa |
12904336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 23 - 186
Target Start/End: Complemental strand, 36098986 - 36098823
Alignment:
| Q |
23 |
aaactggccgattcaccggtttttaccgatttccgccgagccacgccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagac |
122 |
Q |
| |
|
|||| |||||| |||||| |||| |||| ||| |||||| ||| |||||| |||||| |||| |||||| |||||||| | ||| ||||||| | | |
|
|
| T |
36098986 |
aaaccggccgagtcaccgattttgaccggttttggccgagtcacaccggttctcaccgggttgaatgcatgtccgatccatcatgtagctcgaaccggcc |
36098887 |
T |
 |
| Q |
123 |
accccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatgg |
186 |
Q |
| |
|
|| ||||||||||| |||| ||||||||| ||||||||||||| |||||||| |||||||||| |
|
|
| T |
36098886 |
acaccaccggttcacggtcggaccggttcgaccggccggtccggtccggtttttaaaactatgg |
36098823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 67 - 185
Target Start/End: Original strand, 29984121 - 29984239
Alignment:
| Q |
67 |
gccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccga |
166 |
Q |
| |
|
||||||| ||||||||| | |||||| ||||||||||| | | |||||| | ||||| |||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
29984121 |
gccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggttacccctccggttcacggtcggaccgattcaaccggccggtccgg |
29984220 |
T |
 |
| Q |
167 |
gccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
29984221 |
tccggttttcaaaactatg |
29984239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 58 - 185
Target Start/End: Complemental strand, 16216398 - 16216271
Alignment:
| Q |
58 |
ccgagccacgccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccgg |
157 |
Q |
| |
|
|||||||| |||||||| ||||||| |||||||| |||||| ||||| || ||||||| | || ||||||||||| ||| | | |||| |||||| |
|
|
| T |
16216398 |
ccgagccaagccggttttaaccggttcaattgcatgaccgatctgataaacagctcgaaccgggtacaccaccggttcacggttcaatcggtcaaaccgg |
16216299 |
T |
 |
| Q |
158 |
ccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||| |||||| ||| ||||||||| |
|
|
| T |
16216298 |
ccggtccaagccggattttaaaactatg |
16216271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 75 - 186
Target Start/End: Complemental strand, 20130691 - 20130580
Alignment:
| Q |
75 |
acaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttt |
174 |
Q |
| |
|
||||||||| |||||||| |||||||| | | || ||||||| |||| ||| ||||| |||| |||||||||||||||||||||||| ||| ||| |
|
|
| T |
20130691 |
acaccggttctattgcatgaccgatccatttatcagctcgaaccggacatagcactggttcccggtctgaccggttcaaccggccggtccgatccgattt |
20130592 |
T |
 |
| Q |
175 |
taaaaactatgg |
186 |
Q |
| |
|
| |||||||||| |
|
|
| T |
20130591 |
ttaaaactatgg |
20130580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 113 - 188
Target Start/End: Complemental strand, 33627491 - 33627415
Alignment:
| Q |
113 |
cgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccgg-ttttaaaaactatggat |
188 |
Q |
| |
|
|||||| || ||||||||||||| |||| ||||||| | ||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
33627491 |
cgaaccggataccccaccggttcctggttggaccggtccgacccgccggtccgagccggttttttaaaactatggat |
33627415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 67 - 165
Target Start/End: Original strand, 36859013 - 36859111
Alignment:
| Q |
67 |
gccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccg |
165 |
Q |
| |
|
||||||| ||||||||| | |||||| ||||||||||| | | |||||| | ||||| |||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
36859013 |
gccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggttacccctccggttcacggtcggaccggttcgaccggccggtccg |
36859111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 67 - 165
Target Start/End: Original strand, 47424603 - 47424701
Alignment:
| Q |
67 |
gccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccg |
165 |
Q |
| |
|
||||||| ||||||||| | |||||| ||||||||||| | | |||||| | ||||| ||| ||||||||| ||||||||| ||||||||||||| |
|
|
| T |
47424603 |
gccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggttacccctccgattcatggtcggaccggttcgaccggccggtccg |
47424701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 185
Target Start/End: Original strand, 1583216 - 1583261
Alignment:
| Q |
140 |
tccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
1583216 |
tccgaccggttcaaccggccggtccggtccgatttttaaaactatg |
1583261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 112 - 185
Target Start/End: Complemental strand, 14801355 - 14801282
Alignment:
| Q |
112 |
tcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||| | ||||||||||| || ||||| ||||||||||||||||| |||| ||| |||| ||||||||| |
|
|
| T |
14801355 |
tcgaaccggtcaccccaccggatcctggtcgaaccggttcaaccggccgatccggtccgattttcaaaactatg |
14801282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 112 - 185
Target Start/End: Complemental strand, 15248347 - 15248274
Alignment:
| Q |
112 |
tcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||| | ||||||||||| || ||||| ||||||||||||||||| |||| ||| |||| ||||||||| |
|
|
| T |
15248347 |
tcgaaccggtcaccccaccggatcctggtcgaaccggttcaaccggccgatccggtccgattttcaaaactatg |
15248274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 144 - 185
Target Start/End: Complemental strand, 45268720 - 45268679
Alignment:
| Q |
144 |
accggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| ||||||||| |
|
|
| T |
45268720 |
accggttgaaccggccggtccgagccggattttaaaactatg |
45268679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 67 - 135
Target Start/End: Complemental strand, 18249810 - 18249742
Alignment:
| Q |
67 |
gccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttc |
135 |
Q |
| |
|
|||||||||||||| | ||||||||| ||||||||| |||||| |||||| || | ||||||||||| |
|
|
| T |
18249810 |
gccggtttacaccgatccgattgcatgtccgatccaaagaatagaccgaaccggataacccaccggttc |
18249742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 58 - 186
Target Start/End: Complemental strand, 44605168 - 44605040
Alignment:
| Q |
58 |
ccgagccacgccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccgg |
157 |
Q |
| |
|
||||||||||||||||| ||||||| |||||| ||||||| || || || ||||||| | || |||| |||||| |||| |||||| ||||| |
|
|
| T |
44605168 |
ccgagccacgccggttttaaccggttcaattgcacagccgatctgattaacagttcgaaccggtcataccactggttcactgtccaaccggtcggaccgg |
44605069 |
T |
 |
| Q |
158 |
ccggtccgagccggttttaaaaactatgg |
186 |
Q |
| |
|
||||||||||||| ||| |||||||||| |
|
|
| T |
44605068 |
ccggtccgagccgagttttaaaactatgg |
44605040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 125 - 185
Target Start/End: Original strand, 46171475 - 46171535
Alignment:
| Q |
125 |
cccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||||||| ||| ||| |||| |||||||||||| ||||||| ||| ||||||||| |
|
|
| T |
46171475 |
cccaccggttcacggttcgatcggtccaaccggccggttcgagccgagtttcaaaactatg |
46171535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 131; Significance: 6e-68; HSPs: 13)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 33224283 - 33224108
Alignment:
| Q |
1 |
tgttgaaccggtccggttttataaactggccgattcaccggtttttaccgatttccgccgagccacgccggtttacaccggtttgattgcatggccgatc |
100 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33224283 |
tgttgaaccggtccggttttgtaaaccggccgattcaccggtttttaccggtttccgccgagccacgccggttt----------gattgcatggccgatc |
33224194 |
T |
 |
| Q |
101 |
caataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatgg |
186 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33224193 |
caataaatagatcgaaccggacaccccaccggttcatggtccgaccggttcaaccggccggtccgatccggttttaaaaactatgg |
33224108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 122 - 185
Target Start/End: Original strand, 22638786 - 22638849
Alignment:
| Q |
122 |
caccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
22638786 |
caccccaccggttcctggtcggaccggttcaaccggccggtccgatccgattttcaaaactatg |
22638849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 88 - 170
Target Start/End: Original strand, 3756290 - 3756372
Alignment:
| Q |
88 |
tgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccg |
170 |
Q |
| |
|
|||||||||||||||| || | ||||||| | | |||||||||||| |||||||||||| | |||||||||||||||||| |
|
|
| T |
3756290 |
tgcatggccgatccaaatgatggctcgaaccggcctacccaccggttcacggtccgaccggtccgaccggccggtccgagccg |
3756372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 67 - 185
Target Start/End: Complemental strand, 8760326 - 8760208
Alignment:
| Q |
67 |
gccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccga |
166 |
Q |
| |
|
||||||| ||||||||| | |||||| ||||||||||| | | |||||| | ||||| |||||||| |||| ||||||||| |||||||| |||| |
|
|
| T |
8760326 |
gccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggttacccctccggttcacggtcggaccggttcgaccggccgatccgg |
8760227 |
T |
 |
| Q |
167 |
gccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
8760226 |
tccggttttcaaaactatg |
8760208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 88 - 170
Target Start/End: Original strand, 14639143 - 14639225
Alignment:
| Q |
88 |
tgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccg |
170 |
Q |
| |
|
|||||||||||||||| || | ||||||| | | |||||||||||| |||||||||||| | |||||||||||||||||| |
|
|
| T |
14639143 |
tgcatggccgatccaaatgatggctcgaaccggcctacccaccggttcacggtccgaccggtccgaccggccggtccgagccg |
14639225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 112 - 165
Target Start/End: Original strand, 38041367 - 38041420
Alignment:
| Q |
112 |
tcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccg |
165 |
Q |
| |
|
||||||| | |||||||||||||| | ||| ||||||||||||||||||||||| |
|
|
| T |
38041367 |
tcgaaccggtcaccccaccggttcctagtcggaccggttcaaccggccggtccg |
38041420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 128 - 185
Target Start/End: Original strand, 40144656 - 40144713
Alignment:
| Q |
128 |
accggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||||| |||| |||||||||||||| |||||||| |||||||| ||||||||| |
|
|
| T |
40144656 |
accggttcacggtcggaccggttcaaccgaccggtccggcccggttttcaaaactatg |
40144713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 185
Target Start/End: Original strand, 6273971 - 6274031
Alignment:
| Q |
125 |
cccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||||||| ||| |||||||| |||||||||||| ||||||| ||| ||||||||| |
|
|
| T |
6273971 |
cccaccggttcacggttcgaccggtccaaccggccggttcgagccgagtttcaaaactatg |
6274031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 78 - 157
Target Start/End: Complemental strand, 6513873 - 6513794
Alignment:
| Q |
78 |
ccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccgg |
157 |
Q |
| |
|
|||||||||||||||| ||||||| | | | ||||||| | |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
6513873 |
ccggtttgattgcatgaccgatccgtttatcaactcgaaccggtcaccccaccgcttcatggtcggaccggttcaaccgg |
6513794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 126 - 185
Target Start/End: Complemental strand, 32623070 - 32623011
Alignment:
| Q |
126 |
ccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||||| ||||| ||||||||| |||||||||||||| ||| ||| ||||||||| |
|
|
| T |
32623070 |
ccaccggttcctggtcggaccggttcgaccggccggtccgatccgagttttaaaactatg |
32623011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 143 - 185
Target Start/End: Complemental strand, 32382391 - 32382349
Alignment:
| Q |
143 |
gaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||| ||||||||| |
|
|
| T |
32382391 |
gaccggttcaaccagccggtccgagccggattttaaaactatg |
32382349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 112 - 185
Target Start/End: Complemental strand, 33898225 - 33898152
Alignment:
| Q |
112 |
tcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||| | ||||||| |||||| |||| ||||||| |||||||||||| || |||||||| ||||||||| |
|
|
| T |
33898225 |
tcgaaccggccaccccatcggttccaggtcggaccggtccaaccggccggttcggtccggttttcaaaactatg |
33898152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 145 - 185
Target Start/End: Original strand, 29824080 - 29824120
Alignment:
| Q |
145 |
ccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||||||||||||||||||| || ||| ||||||||| |
|
|
| T |
29824080 |
ccggttcaaccggccggtccgagctgggttttaaaactatg |
29824120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 111; Significance: 5e-56; HSPs: 12)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 186 - 308
Target Start/End: Complemental strand, 28521259 - 28521137
Alignment:
| Q |
186 |
gatactagtattaaatttgaaataagtctcctcacattctcctatgcctctgcaacactctccccccactgcataagttgctgccacacgccaagtgaat |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
28521259 |
gatactagtattaaatttgaaataagtctcctcacattctcatatgcctctgcaacactctccccccactgcatcagttgctgccacatgccaagtgaat |
28521160 |
T |
 |
| Q |
286 |
ttccactttatctcttccctatg |
308 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28521159 |
ttccactttatctcttccctatg |
28521137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 23 - 185
Target Start/End: Complemental strand, 40484851 - 40484689
Alignment:
| Q |
23 |
aaactggccgattcaccggtttttaccgatttccgccgagccacgccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagac |
122 |
Q |
| |
|
|||| |||||| |||||| |||| |||| ||| |||||| ||| |||||| |||||| |||| |||||| |||||||| | ||| ||||||| | | |
|
|
| T |
40484851 |
aaaccggccgagtcaccgattttgaccggttttggccgagtcacaccggttctcaccgggttgaatgcatgtccgatccatcatgtagctcgaaccggcc |
40484752 |
T |
 |
| Q |
123 |
accccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|| ||||||||||| |||| ||||||||| ||||||||||||| |||||||| ||||||||| |
|
|
| T |
40484751 |
acaccaccggttcacggtcggaccggttcgaccggccggtccggtccggtttttaaaactatg |
40484689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 35 - 185
Target Start/End: Complemental strand, 38209862 - 38209712
Alignment:
| Q |
35 |
tcaccggtttttaccgatttccgccgagccacgccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggtt |
134 |
Q |
| |
|
|||||||||||||||| ||| |||| | || |||||| || ||||||| | ||||||||||||| || ||| ||||||| ||||| |||||| |
|
|
| T |
38209862 |
tcaccggtttttaccggttttggccgggtcattccggttcacgccggtttaaaagcatggccgatccgttagctagctcgaaccgcttacccctccggtt |
38209763 |
T |
 |
| Q |
135 |
catggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
| |||||| |||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
38209762 |
cttggtccaaccggttcgaccggccggtccgagccggtttttaaaactatg |
38209712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 122 - 185
Target Start/End: Complemental strand, 27678622 - 27678559
Alignment:
| Q |
122 |
caccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
27678622 |
caccccaccggttcctggtcggaccggttcaaccggccggtccggtccggttttcaaaactatg |
27678559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 95 - 186
Target Start/End: Complemental strand, 45218847 - 45218756
Alignment:
| Q |
95 |
ccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatgg |
186 |
Q |
| |
|
|||||||||||| |||||||||||||| || ||||||||||| ||| | |||||| |||| |||||||||||||| ||| |||||||||| |
|
|
| T |
45218847 |
ccgatccaataagtagatcgaaccagatacaccaccggttcacggttcaaccggtcggaccgtccggtccgagccgggttttaaaactatgg |
45218756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 112 - 185
Target Start/End: Original strand, 3656554 - 3656627
Alignment:
| Q |
112 |
tcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||| | || |||||||||||| |||| ||||||||||||||||||||||| || ||||| ||||||||| |
|
|
| T |
3656554 |
tcgaaccggtcatcccaccggttcacggtcggaccggttcaaccggccggtccggtccagttttcaaaactatg |
3656627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 129 - 184
Target Start/End: Original strand, 14910917 - 14910972
Alignment:
| Q |
129 |
ccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactat |
184 |
Q |
| |
|
|||||||| |||| ||||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
14910917 |
ccggttcacggtcggaccggttcgaccggccggtccgatccggttttcaaaactat |
14910972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 112 - 185
Target Start/End: Complemental strand, 5969369 - 5969296
Alignment:
| Q |
112 |
tcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||| | ||||||| |||||| ||||| |||| |||||||||||||||||| |||||||| || |||||| |
|
|
| T |
5969369 |
tcgaaccggtcaccccatcggttcctggtcggaccagttcaaccggccggtccggtccggttttcaatactatg |
5969296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 132 - 185
Target Start/End: Complemental strand, 13486508 - 13486455
Alignment:
| Q |
132 |
gttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
13486508 |
gttcatggtcggaccggttcaaccggccggtccggtccgcttttcaaaactatg |
13486455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 145 - 185
Target Start/End: Original strand, 6546497 - 6546537
Alignment:
| Q |
145 |
ccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
6546497 |
ccggttcaaccggccggtccgagccgggttttaaaactatg |
6546537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 145 - 186
Target Start/End: Complemental strand, 8014191 - 8014150
Alignment:
| Q |
145 |
ccggttcaaccggccggtccgagccggttttaaaaactatgg |
186 |
Q |
| |
|
|||||| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
8014191 |
ccggttgaaccggccggtccgagccgggttttaaaactatgg |
8014150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 14 - 134
Target Start/End: Complemental strand, 28761098 - 28760978
Alignment:
| Q |
14 |
cggttttataaactggccgattcaccggtttttaccgatttccgccgagccacgccggtttacaccggtttgattgcatggccgatccaataaatagatc |
113 |
Q |
| |
|
||||| ||||||| |||||| || |||||||| |||| ||| ||||||| || ||||||||||||| | | |||||| |||||||||| | || || |
|
|
| T |
28761098 |
cggttctataaaccggccgagtcgccggttttgaccggttttaaacgagccatgctggtttacaccggtctaactgcatgaccgatccaatgagaagctc |
28760999 |
T |
 |
| Q |
114 |
gaaccagacaccccaccggtt |
134 |
Q |
| |
|
||||| || |||| ||||||| |
|
|
| T |
28760998 |
gaaccggataccctaccggtt |
28760978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 12)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 30 - 136
Target Start/End: Original strand, 14886214 - 14886320
Alignment:
| Q |
30 |
ccgattcaccggtttttaccgatttccgccgagccacgccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccac |
129 |
Q |
| |
|
|||||||| ||||||||||||||||||||| || |||||||||||||||||||| ||||||||| |||||||||||| ||| |||||| | |||| ||| |
|
|
| T |
14886214 |
ccgattcatcggtttttaccgatttccgccaagtcacgccggtttacaccggttcaattgcatggtcgatccaataaaaagaccgaaccggccaccgcac |
14886313 |
T |
 |
| Q |
130 |
cggttca |
136 |
Q |
| |
|
||||||| |
|
|
| T |
14886314 |
cggttca |
14886320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 6 - 185
Target Start/End: Complemental strand, 37314406 - 37314227
Alignment:
| Q |
6 |
aaccggtccggttttataaactggccgattcaccggtttttaccgatttccgccgagccacgccggtttacaccggtttgattgcatggccgatccaata |
105 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||||| | || || |||| |||||||||| | ||||||||||| |||| ||||||| | |
|
|
| T |
37314406 |
aaccggtccggtttgtcaaacccgccggttcaccggtttttcctgagtttgaccgaatcacgccggttcagtccggtttgattacatgaccgatccgttt |
37314307 |
T |
 |
| Q |
106 |
aatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
| | ||||||| | |||||||||||||| ||||| ||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
37314306 |
atcaactcgaaccggtcaccccaccggttcctggtcggaccggttcaaccggccggtccggtccggttttcaaaactatg |
37314227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 120 - 186
Target Start/End: Complemental strand, 43869027 - 43868961
Alignment:
| Q |
120 |
gacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatgg |
186 |
Q |
| |
|
||||| ||||||||||| | | |||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43869027 |
gacacaccaccggttcacgattcgaccggtccaaccggccggtccgagccggtttttaaaactatgg |
43868961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 57 - 185
Target Start/End: Original strand, 12341111 - 12341239
Alignment:
| Q |
57 |
gccgagccacgccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccg |
156 |
Q |
| |
|
|||||| ||| |||||| || |||||| | ||||||||||||||| || || ||||||| ||||||||| |||| ||||| |||||||| |||| |
|
|
| T |
12341111 |
gccgagtcactccggttcacgccggttcaaatgcatggccgatccattagttaactcgaaccgcttaccccaccgcttcacggtccaaccggttcgaccg |
12341210 |
T |
 |
| Q |
157 |
gccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||||||||||| ||| ||||||||| |
|
|
| T |
12341211 |
gccggtccgagccgggttttaaaactatg |
12341239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 76 - 185
Target Start/End: Original strand, 18541452 - 18541561
Alignment:
| Q |
76 |
caccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggtttt |
175 |
Q |
| |
|
||||||||| | |||||| ||||||||||| || | |||||| | ||||| |||||||| |||| ||| ||||| ||||||||||||| |||||||| |
|
|
| T |
18541452 |
caccggtttaaatgcatgaccgatccaatatatcaaccgaaccggttacccctccggttcacggtcggactggttcgaccggccggtccggtccggtttt |
18541551 |
T |
 |
| Q |
176 |
aaaaactatg |
185 |
Q |
| |
|
||||||||| |
|
|
| T |
18541552 |
caaaactatg |
18541561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 137 - 189
Target Start/End: Complemental strand, 10809820 - 10809768
Alignment:
| Q |
137 |
tggtccgaccggttcaaccggccggtccgagccggttttaaaaactatggata |
189 |
Q |
| |
|
||||| |||||||| |||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
10809820 |
tggtcggaccggttgaaccggccggtccgagtcggtttttaaaactatggata |
10809768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 6 - 187
Target Start/End: Original strand, 7502049 - 7502230
Alignment:
| Q |
6 |
aaccggtccggttttataaactggccgattcaccggtttttaccgatttccgccgagccacgccggtttacaccggtttgattgcatggccgatccaata |
105 |
Q |
| |
|
|||||||||||||| ||||| |||| |||||||||||| |||| || || ||| || |||||| | ||||||||||| || ||||||||| | |
|
|
| T |
7502049 |
aaccggtccggtttgttaaacccgccggttcaccggttttcaccgggtttggcagagttacaccggttcaggccggtttgattacacggccgatccgtca |
7502148 |
T |
 |
| Q |
106 |
aatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatgga |
187 |
Q |
| |
|
| | ||||||| | |||| |||||||| ||||| |||||||| |||||||||||||| |||| ||| ||||||||||| |
|
|
| T |
7502149 |
agcaactcgaaccggttaccctaccggttcctggtcggaccggttgaaccggccggtccggtccgggtttcaaaactatgga |
7502230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 142 - 185
Target Start/End: Complemental strand, 12364704 - 12364661
Alignment:
| Q |
142 |
cgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
12364704 |
cgaccggtccaaccggccggtccgagccgggttttaaaactatg |
12364661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 112 - 186
Target Start/End: Original strand, 3989733 - 3989807
Alignment:
| Q |
112 |
tcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatgg |
186 |
Q |
| |
|
||||||| |||| |||||||||| |||| ||||||| | ||||||||||||| |||||||| |||||||||| |
|
|
| T |
3989733 |
tcgaaccggacataccaccggttcccggtctgaccggtccgaccggccggtccggtccggtttttaaaactatgg |
3989807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 128 - 186
Target Start/End: Complemental strand, 6064888 - 6064830
Alignment:
| Q |
128 |
accggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatgg |
186 |
Q |
| |
|
|||||||| |||| ||||||||| |||| ||| |||||||||||||| |||||||||| |
|
|
| T |
6064888 |
accggttcccggtcggaccggttcgaccgaccgttccgagccggtttttaaaactatgg |
6064830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 144 - 185
Target Start/End: Original strand, 19882766 - 19882807
Alignment:
| Q |
144 |
accggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| ||||||||| |
|
|
| T |
19882766 |
accggttgaaccggccggtccgagccgggttttaaaactatg |
19882807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 144 - 185
Target Start/End: Original strand, 23251787 - 23251828
Alignment:
| Q |
144 |
accggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| ||||||||| |
|
|
| T |
23251787 |
accggttgaaccggccggtccgagccgggttttaaaactatg |
23251828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 3 - 98
Target Start/End: Original strand, 52602 - 52697
Alignment:
| Q |
3 |
ttgaaccggtccggttttataaactggccgattcaccggtttttaccgatttccgccgagccacgccggtttacaccggtttgattgcatggccga |
98 |
Q |
| |
|
|||||||| ||||||| | |||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |||||||| |||| |
|
|
| T |
52602 |
ttgaaccgctccggttctgaaaaccggccgattcaccggtttttaccggtttccgccgagtcacgccggtttacaccggttcaattgcatgaccga |
52697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 122 - 185
Target Start/End: Original strand, 52704 - 52767
Alignment:
| Q |
122 |
caccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||| ||||||| |||| ||||||||||||||| |||||||| |||||||| ||||||||| |
|
|
| T |
52704 |
caccccatcggttcacggtcggaccggttcaaccggtcggtccgatccggtttttaaaactatg |
52767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 16)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 6 - 185
Target Start/End: Original strand, 44258408 - 44258587
Alignment:
| Q |
6 |
aaccggtccggttttataaactggccgattcaccggtttttaccgatttccgccgagccacgccggtttacaccggtttgattgcatggccgatccaata |
105 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||||| |||| || ||||| |||||| ||| | ||||||||||| |||| |||||||| | |
|
|
| T |
44258408 |
aaccggtccggtttgtcaaacccgccggttcaccggtttttcccgagtttgaccgagtcacgccagttcagtccggtttgattacatgaccgatccattt |
44258507 |
T |
 |
| Q |
106 |
aatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
| | ||||||| | |||||||||||||| ||||| ||||||||||||||| ||||||| ||| |||| ||||||||| |
|
|
| T |
44258508 |
atcaactcgaaccggtcaccccaccggttcctggtcggaccggttcaaccggacggtccggtccgattttcaaaactatg |
44258587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 23 - 185
Target Start/End: Original strand, 28235605 - 28235767
Alignment:
| Q |
23 |
aaactggccgattcaccggtttttaccgatttccgccgagccacgccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagac |
122 |
Q |
| |
|
|||| |||||| |||||| |||| |||| ||| |||||| ||| |||||| |||||| |||| |||||| |||||||| | ||| ||||||| | | |
|
|
| T |
28235605 |
aaaccggccgagtcaccgattttgaccggttttggccgagtcacaccggttctcaccgggttgaatgcatgtccgatccatcatgtagctcgaaccggcc |
28235704 |
T |
 |
| Q |
123 |
accccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|| |||||| |||| |||| ||||||||| ||||||||||||| |||||||| ||||||||| |
|
|
| T |
28235705 |
acaccaccgattcacggtcggaccggttcgaccggccggtccggtccggtttttaaaactatg |
28235767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 127 - 185
Target Start/End: Original strand, 32364973 - 32365031
Alignment:
| Q |
127 |
caccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||||| |||| ||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
32364973 |
caccggttcacggtcggaccggttcgaccggccggtccgagccggtttttaaaactatg |
32365031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 112 - 186
Target Start/End: Complemental strand, 27414406 - 27414333
Alignment:
| Q |
112 |
tcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatgg |
186 |
Q |
| |
|
||||||| | ||||||||||||||| |||| |||||||||||||||||||| ||| | |||||| |||||||||| |
|
|
| T |
27414406 |
tcgaaccggccaccccaccggttca-ggtcggaccggttcaaccggccggttcgatctggttttcaaaactatgg |
27414333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 125 - 187
Target Start/End: Original strand, 33690862 - 33690924
Alignment:
| Q |
125 |
cccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatgga |
187 |
Q |
| |
|
||||||||||| ||||| |||||||| ||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
33690862 |
cccaccggttcctggtcggaccggtttgaccggccggtccgagacggtttttaaaactatgga |
33690924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 123 - 185
Target Start/End: Original strand, 52586091 - 52586153
Alignment:
| Q |
123 |
accccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||| ||||||| |||||| |||||||| ||||||||||||||| ||||||| ||||||||| |
|
|
| T |
52586091 |
acccctccggttcttggtccaaccggttcgaccggccggtccgagtcggtttttaaaactatg |
52586153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 125 - 185
Target Start/End: Original strand, 24639595 - 24639655
Alignment:
| Q |
125 |
cccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||||||| ||| ||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
24639595 |
cccaccggttccaggttggaccggttcgaccggccggtccgagccggtttttaaaactatg |
24639655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 68 - 165
Target Start/End: Original strand, 18033470 - 18033567
Alignment:
| Q |
68 |
ccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccag-acaccccaccggttcatggtccgaccggttcaaccggccggtccg |
165 |
Q |
| |
|
||||||| | ||||||| |||||||||||||||||||||| | ||||||| | ||| ||| ||| |||| |||| ||||||||| ||||||||||||| |
|
|
| T |
18033470 |
ccggtttgcgccggtttaattgcatggccgatccaataaaaggctcgaaccggcaca-ccctccgattcacggtcggaccggttcgaccggccggtccg |
18033567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 67 - 185
Target Start/End: Complemental strand, 50358021 - 50357903
Alignment:
| Q |
67 |
gccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccga |
166 |
Q |
| |
|
||||||| || ||||||| | ||||||||||||| || ||| |||||||| ||||| ||||||| ||||| |||| ||| |||||||||||||| |
|
|
| T |
50358021 |
gccggttcactccggtttaaaagcatggccgatccgttagctagttcgaaccacttacccctccggttctcggtccaaccgattcgaccggccggtccga |
50357922 |
T |
 |
| Q |
167 |
gccggttttaaaaactatg |
185 |
Q |
| |
|
||||||||| |||| |||| |
|
|
| T |
50357921 |
gccggtttttaaaagtatg |
50357903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 58 - 186
Target Start/End: Complemental strand, 37034274 - 37034146
Alignment:
| Q |
58 |
ccgagccacgccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccgg |
157 |
Q |
| |
|
|||||||| |||||||| ||||||| |||||||| |||||| ||||| | || |||| || || ||||||||| | ||||| |||||| ||||| |
|
|
| T |
37034274 |
ccgagccaagccggttttaaccggttcaattgcatgaccgatctgataaacaactcaaaccggatacaccaccggtttacggtccaaccggtcagaccgg |
37034175 |
T |
 |
| Q |
158 |
ccggtccgagccggttttaaaaactatgg |
186 |
Q |
| |
|
||||||| |||||| ||| |||||||||| |
|
|
| T |
37034174 |
ccggtccaagccgggttttaaaactatgg |
37034146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 58 - 185
Target Start/End: Complemental strand, 5384138 - 5384011
Alignment:
| Q |
58 |
ccgagccacgccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccgg |
157 |
Q |
| |
|
|||||||| |||||||| ||||||| |||||||| || ||| ||||| || ||||||| || ||| ||||||| ||||| |||||| ||||| |
|
|
| T |
5384138 |
ccgagccaagccggttttaaccggttcaattgcatgaccaatctgataaacagctcgaaccgagtacaccaacggttcacggtccaaccggtcggaccgg |
5384039 |
T |
 |
| Q |
158 |
ccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||||||||| ||| ||||||||| |
|
|
| T |
5384038 |
ccggtccgagccgggttttaaaactatg |
5384011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 67 - 186
Target Start/End: Original strand, 12793543 - 12793662
Alignment:
| Q |
67 |
gccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccga |
166 |
Q |
| |
|
||||||| ||||||||| | |||||| ||||||||||| | | |||||||| ||||| || ||||| |||| ||||||||| || | |||||||| |
|
|
| T |
12793543 |
gccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccagttacccctccagttcacggtcggaccggttcgactgaccggtccgg |
12793642 |
T |
 |
| Q |
167 |
gccggttttaaaaactatgg |
186 |
Q |
| |
|
|||||||| |||||||||| |
|
|
| T |
12793643 |
tccggttttcaaaactatgg |
12793662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 78 - 164
Target Start/End: Original strand, 20726793 - 20726879
Alignment:
| Q |
78 |
ccggtttgattgcatggccgatccaataaatagatcgaaccagacac-cccaccggttcatggtccgaccggttcaaccggccggtcc |
164 |
Q |
| |
|
||||||| ||| |||||||||||| ||||| | ||||||| ||||| ||| |||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
20726793 |
ccggtttaattacatggccgatccgataaaaggctcgaacc-gacacaccctccggttcacggtcggaccggttcgaccggccggtcc |
20726879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 185
Target Start/End: Complemental strand, 19553385 - 19553323
Alignment:
| Q |
123 |
accccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||| || |||| |||||| |||||||| |||||||||||||| || ||||| ||||||||| |
|
|
| T |
19553385 |
acccctccagttcttggtccaaccggttcgaccggccggtccgaaccagtttttaaaactatg |
19553323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 14 - 103
Target Start/End: Original strand, 45484718 - 45484807
Alignment:
| Q |
14 |
cggttttataaactggccgattcaccggtttttaccgatttccgccgagccacgccggtttacaccggtttgattgcatggccgatccaa |
103 |
Q |
| |
|
||||| ||||||| |||||| ||||||||||| ||| ||| ||||||| |||||||||||||||| | | |||||| ||||||||| |
|
|
| T |
45484718 |
cggttctataaaccggccgagtcaccggttttgaccagttttaaacgagccatgccggtttacaccggtctaactgcatgaccgatccaa |
45484807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 95 - 183
Target Start/End: Original strand, 37670719 - 37670807
Alignment:
| Q |
95 |
ccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaacta |
183 |
Q |
| |
|
||||||||| | |||| |||||| ||||| ||||||||||| ||| |||||||| | | |||||||| |||| |||||| ||||||| |
|
|
| T |
37670719 |
ccgatccaaaagttagaccgaaccggacacaccaccggttcacggttcgaccggtccgatcggccggtttgagctggtttttaaaacta |
37670807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 35 - 185
Target Start/End: Complemental strand, 28739 - 28589
Alignment:
| Q |
35 |
tcaccggtttttaccgatttccgccgagccacgccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggtt |
134 |
Q |
| |
|
||||| |||||||||| ||| |||| | || |||||| || ||||||| | ||||||||||||| || ||| |||||||| ||||| |||||| |
|
|
| T |
28739 |
tcaccagtttttaccggttttggccgggtcattccggttcacgccggtttaaaagcatggccgatccgttacctagctcgaaccacttacccctccggtt |
28640 |
T |
 |
| Q |
135 |
catggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
| |||||| |||||||| ||||||||||||||||| ||||| ||||||||| |
|
|
| T |
28639 |
cttggtccaaccggttcgaccggccggtccgagccagtttttaaaactatg |
28589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 15)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 122 - 186
Target Start/End: Complemental strand, 37599249 - 37599185
Alignment:
| Q |
122 |
caccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatgg |
186 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||| | ||| |||| |||||||||| |
|
|
| T |
37599249 |
caccccaccggttcctggtcggaccggttcaaccggccggtccaatccgattttcaaaactatgg |
37599185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 125 - 185
Target Start/End: Original strand, 42908678 - 42908738
Alignment:
| Q |
125 |
cccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||||||| |||| ||||||||| |||||||||||||||| |||||| ||||||||| |
|
|
| T |
42908678 |
cccaccggttcacggtcggaccggttcgaccggccggtccgagctggtttttaaaactatg |
42908738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 127 - 185
Target Start/End: Complemental strand, 51536432 - 51536374
Alignment:
| Q |
127 |
caccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
51536432 |
caccggttcacggtcggaccggttcgaccggccggtccgatccggtttttaaaactatg |
51536374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 131 - 186
Target Start/End: Original strand, 29728805 - 29728860
Alignment:
| Q |
131 |
ggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatgg |
186 |
Q |
| |
|
|||||| |||| ||||||||| ||||||||||||||||| ||||| |||||||||| |
|
|
| T |
29728805 |
ggttcacggtcggaccggttcgaccggccggtccgagccagtttttaaaactatgg |
29728860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 78 - 165
Target Start/End: Original strand, 39851382 - 39851469
Alignment:
| Q |
78 |
ccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccg |
165 |
Q |
| |
|
|||||||||||||||| ||||||| | | | ||||||| | |||| |||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
39851382 |
ccggtttgattgcatgaccgatccgtttatcaactcgaaccggtcacctcaccggttcacggtcggaccggttcaaccggccggtccg |
39851469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 185
Target Start/End: Complemental strand, 2848556 - 2848494
Alignment:
| Q |
123 |
accccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||| |||||||| |||| ||||||||| ||||||||||||| |||||||| ||||||||| |
|
|
| T |
2848556 |
acccctccggttcacggtcggaccggttcgaccggccggtccggtccggtttttaaaactatg |
2848494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 6 - 184
Target Start/End: Complemental strand, 11675727 - 11675549
Alignment:
| Q |
6 |
aaccggtccggttttataaactggccgattcaccggtttttaccgatttccgccgagccacgccggtttacaccggtttgattgcatggccgatccaata |
105 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||||| | || || ||||| |||||||||| | ||| ||||||| |||| ||||||| | |
|
|
| T |
11675727 |
aaccggtccggtttgtcaaacccgccggttcaccggtttttcctgagtttgaccgagtcacgccggttcattccgatttgattacatgaccgatccgttt |
11675628 |
T |
 |
| Q |
106 |
aatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactat |
184 |
Q |
| |
|
| | ||||||| | |||||||||||||| ||||| ||||| ||||||||| ||||||| ||| |||| |||||||| |
|
|
| T |
11675627 |
atcaactcgaaccggtcaccccaccggttcctggtcggaccgattcaaccggtcggtccggtccgattttcaaaactat |
11675549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 138 - 182
Target Start/End: Original strand, 15101427 - 15101471
Alignment:
| Q |
138 |
ggtccgaccggttcaaccggccggtccgagccggttttaaaaact |
182 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
15101427 |
ggtcggaccggttcgaccggccggtccgagccggttttcaaaact |
15101471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 185
Target Start/End: Complemental strand, 16056862 - 16056802
Alignment:
| Q |
125 |
cccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||| |||||| |||| ||||||||| ||| ||||||||||||||||||| ||||||||| |
|
|
| T |
16056862 |
cccatcggttcccggtcggaccggttcgaccagccggtccgagccggtttttaaaactatg |
16056802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 128 - 188
Target Start/End: Complemental strand, 30464554 - 30464494
Alignment:
| Q |
128 |
accggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatggat |
188 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||| | | |||| |||||||||||| |
|
|
| T |
30464554 |
accggttcctggtcggaccggttcaaccggccggtccggtctgattttcaaaactatggat |
30464494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 123 - 186
Target Start/End: Complemental strand, 10258376 - 10258313
Alignment:
| Q |
123 |
accccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatgg |
186 |
Q |
| |
|
||||| |||||||| |||||||| ||||| | ||||||||||| |||||||| |||||||||| |
|
|
| T |
10258376 |
acccctccggttcacggtccgactggttcgatcggccggtccggtccggttttcaaaactatgg |
10258313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 138 - 185
Target Start/End: Complemental strand, 42216523 - 42216476
Alignment:
| Q |
138 |
ggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||| ||||||||| ||||||||||| ||||||||||| ||||||||| |
|
|
| T |
42216523 |
ggtcggaccggttcgaccggccggtctgagccggtttttaaaactatg |
42216476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 58 - 185
Target Start/End: Complemental strand, 52403768 - 52403641
Alignment:
| Q |
58 |
ccgagccacgccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccgg |
157 |
Q |
| |
|
|||||||| |||| ||| ||||||| |||||||| |||||| ||||| || | ||||| || || ||||||||||| ||| | |||||| ||||| |
|
|
| T |
52403768 |
ccgagccaagccgattttaaccggttcaattgcatgaccgatctgataaacagcttgaaccggatacaccaccggttcacggttcaaccggtcggaccgg |
52403669 |
T |
 |
| Q |
158 |
ccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|| ||||||||||| ||| ||||||||| |
|
|
| T |
52403668 |
ccagtccgagccgggttttaaaactatg |
52403641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 143 - 185
Target Start/End: Complemental strand, 23241361 - 23241319
Alignment:
| Q |
143 |
gaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
23241361 |
gaccggttcaaccggccggtccggtccggttttcaaaactatg |
23241319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 67 - 185
Target Start/End: Original strand, 33635758 - 33635876
Alignment:
| Q |
67 |
gccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccga |
166 |
Q |
| |
|
||||||| ||||||||| | |||||| ||||||||||| | | |||||| | ||||| ||| |||| |||| ||||||||| |||||||| |||| |
|
|
| T |
33635758 |
gccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggttacccctccgattcacggtcggaccggttcgaccggccgatccgg |
33635857 |
T |
 |
| Q |
167 |
gccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
33635858 |
tccggttttcaaaactatg |
33635876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0332 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0332
Description:
Target: scaffold0332; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 59 - 185
Target Start/End: Complemental strand, 1771 - 1645
Alignment:
| Q |
59 |
cgagccacgccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggc |
158 |
Q |
| |
|
|||| |||||||||| |||||||| || |||| ||||||||| || |||||||||| ||||| ||||||||||| ||| | |||||| |||||| |
|
|
| T |
1771 |
cgagtcacgccggttctcaccggttcgactgcacaaccgatccaacaagtagatcgaactggacacaccaccggttcacggttcaaccggtctgaccggc |
1672 |
T |
 |
| Q |
159 |
cggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||| |||||||| ||||||||| |
|
|
| T |
1671 |
aggtccgaaccggtttttaaaactatg |
1645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 112 - 185
Target Start/End: Original strand, 13416 - 13489
Alignment:
| Q |
112 |
tcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||| | |||||||||| ||| ||||| |||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
13416 |
tcgaaccggtcaccccaccgcttcctggtcggaccggttcaaccggccggttcggtccggttttcaaaactatg |
13489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0242 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0242
Description:
Target: scaffold0242; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 130 - 165
Target Start/End: Complemental strand, 17012 - 16977
Alignment:
| Q |
130 |
cggttcatggtccgaccggttcaaccggccggtccg |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
17012 |
cggttcatggtccgaccggttcaaccggccggtccg |
16977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 68 - 186
Target Start/End: Original strand, 138353 - 138471
Alignment:
| Q |
68 |
ccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacac-cccaccggttcatggtccgaccggttcaaccggccggtccga |
166 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| || | | | ||||||| |||| |||| |||||| |||| ||||||||| ||| |||||||||| |
|
|
| T |
138353 |
ccggtttataccggtttagttgcatggccgatctaacatttggctcgaacc-gacatacccaacggttccaggtcggaccggttcgaccagccggtccga |
138451 |
T |
 |
| Q |
167 |
gccggttttaaaaactatgg |
186 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
138452 |
gccggttttgaaaactatgg |
138471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 185
Target Start/End: Complemental strand, 22350533 - 22350471
Alignment:
| Q |
123 |
accccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||| |||||||| |||| ||||||||| ||||||||||||| |||||||| ||||||||| |
|
|
| T |
22350533 |
acccctccggttcacggtcggaccggttcgaccggccggtccggtccggttttcaaaactatg |
22350471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 143 - 185
Target Start/End: Complemental strand, 9367559 - 9367517
Alignment:
| Q |
143 |
gaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
9367559 |
gaccggttcaaccggccggtccgagctagtttttaaaactatg |
9367517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 143 - 185
Target Start/End: Original strand, 11466197 - 11466239
Alignment:
| Q |
143 |
gaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
11466197 |
gaccggttcaaccggccggtccggtccggttttcaaaactatg |
11466239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 185
Target Start/End: Complemental strand, 21528161 - 21528099
Alignment:
| Q |
123 |
accccaccggttcatggtccgaccggttcaaccggccggtccgagccggttttaaaaactatg |
185 |
Q |
| |
|
|||| |||||||| ||||| |||||||| |||||||||||||| |||| ||| ||||||||| |
|
|
| T |
21528161 |
accctaccggttcctggtcggaccggttgaaccggccggtccggtccgggtttcaaaactatg |
21528099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0116 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0116
Description:
Target: scaffold0116; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 68 - 185
Target Start/End: Original strand, 8610 - 8727
Alignment:
| Q |
68 |
ccggtttacaccggtttgattgcatggccgatccaataaatagatcgaaccagacaccccaccggttcatggtccgaccggttcaaccggccggtccgag |
167 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||| || | | | |||||| | |||| |||||| |||| || |||||| ||||||||||||||| |
|
|
| T |
8610 |
ccggtttataccggtttaattgcatggccgatctaacatttggctcgaacgggcatacccatcggttccaggtcggatcggttcgaccggccggtccgag |
8709 |
T |
 |
| Q |
168 |
ccggttttaaaaactatg |
185 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
8710 |
ccggttttgaaaactatg |
8727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University