View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17326_high_51 (Length: 227)
Name: NF17326_high_51
Description: NF17326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17326_high_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 43021104 - 43020909
Alignment:
| Q |
16 |
cataggccgatgaaatcaatgactagaaatattgtaaattacacaatgtgattggtcacaccactaatgaatatttctgtttcaaggatatgatatgatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43021104 |
cataggccgatgaaatcaatgactagaaatattgtaaattacacaatgtgattggtcacaccactaatgaatatttctgtttcaaggatatgatatgatt |
43021005 |
T |
 |
| Q |
116 |
cggaaagtaataaaaacaggaagattgaatttcgattggcaggaaatcgaacatgaaagtaatggcaatggacaggtacccttgaacatcgtgatg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
43021004 |
cggaaagtaataaaaacaggaagattgaatttcgattggcaggaaatcgaacatgaaagtattggcaatggacaggtacccttgaacatcgagatg |
43020909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University