View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17326_high_56 (Length: 211)
Name: NF17326_high_56
Description: NF17326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17326_high_56 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 59 - 198
Target Start/End: Complemental strand, 44079708 - 44079569
Alignment:
| Q |
59 |
acaccaaagttgatatgattcttcaaaacatttactacgtgcatgataaattgtcaagcatactatttcacatgataataacaaacttaaataagatctc |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44079708 |
acaccaaagttgatatgattcttcaaaacatttactacgtgcatgataaattgtcaagaatactatttcacatgataataacaaacttaaataagatctc |
44079609 |
T |
 |
| Q |
159 |
gtgcaactgtacatatcaatacaagacagaggtcaaagtt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44079608 |
gtgcaactgtacatatcaatacaagacagaggtcaaagtt |
44079569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University