View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17326_low_52 (Length: 247)
Name: NF17326_low_52
Description: NF17326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17326_low_52 |
 |  |
|
| [»] scaffold0903 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 15 - 180
Target Start/End: Complemental strand, 21717049 - 21716884
Alignment:
| Q |
15 |
gacatcatctgcttggggttacgaccaccgctgtttgggttacggccaatgctgcggaatccaccaccaatattgcgcgatccaccgtttccagaaattg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
21717049 |
gacatcatctgcttggggttacgaccaccgctgtttgggttacggccactgctgcgggatccaccaccaatattgcacgatccaccgtttctggaaattg |
21716950 |
T |
 |
| Q |
115 |
aaaatgagtgagatcctctgctattcgaatactctctactgcttgacatcttcgtgcaatgattgg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
21716949 |
aaaatgagtgagatcctctgctattcgaataccctctactgcttgacatcttcgcgcaatgattgg |
21716884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 27 - 136
Target Start/End: Original strand, 20656645 - 20656754
Alignment:
| Q |
27 |
ttggggttacgaccaccgctgtttgggttacggccaatgctgcggaatccaccaccaatattgcgcgatccaccgtttccagaaattgaaaatgagtgag |
126 |
Q |
| |
|
|||| |||||||||||| |||||| |||||| ||| | |||| ||| ||||||| | ||||| ||||||||||||| ||| |||||||||||||||| |
|
|
| T |
20656645 |
ttggtgttacgaccaccattgtttgcgttacgaccaccgttgcgagatctaccaccactcttgcgggatccaccgtttctagagattgaaaatgagtgag |
20656744 |
T |
 |
| Q |
127 |
atcctctgct |
136 |
Q |
| |
|
| |||||||| |
|
|
| T |
20656745 |
aacctctgct |
20656754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0903 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: scaffold0903
Description:
Target: scaffold0903; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 18 - 180
Target Start/End: Complemental strand, 629 - 467
Alignment:
| Q |
18 |
atcatctgcttggggttacgaccaccgctgtttgggttacggccaatgctgcggaatccaccaccaatattgcgcgatccaccgtttccagaaattgaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| ||| || |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
629 |
atcatctgcttggggttacgaccaccgctgtttgggttacgaccaccgctatttgggttacgaccaatattgcgcgatccaccgtttctggaaattgaaa |
530 |
T |
 |
| Q |
118 |
atgagtgagatcctctgctattcgaatactctctactgcttgacatcttcgtgcaatgattgg |
180 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||| ||| ||||||||||| |
|
|
| T |
529 |
atgagtgagatcctctgctattcgaataccctctattgcttgacatcatcgcgcaatgattgg |
467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University