View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17326_low_54 (Length: 241)
Name: NF17326_low_54
Description: NF17326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17326_low_54 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 13 - 241
Target Start/End: Complemental strand, 479413 - 479185
Alignment:
| Q |
13 |
tgtttgacataacattgtgcttcacgtgaaaaagatgaacgaacgcattcaacaccacaaataagaagacacaacaactcaatgagtaattaacatgcag |
112 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
479413 |
tgtttgacataagattgtgcttcacgtgaaaaagatgaacgaacgcattcaacaccacaaataagaagacacaacaactcaatgagtaattaacatgcag |
479314 |
T |
|
| Q |
113 |
ttgagtttcttgtcaatattcaattcattttacactatagttagtttcatgtgacatgtatgtatgtatgacatnnnnnnnggaatgctcaaggaggccc |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
479313 |
ttgagtttcttgtcaatattcagttcattttacactatagttagtttcatgtgacatgtatgtatgtatgacataaaaaaaggaatgctcaaggaggccc |
479214 |
T |
|
| Q |
213 |
aaggtaaagaacattcactgactcacctc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
479213 |
aaggtaaagaacattcactgactcacctc |
479185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University