View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17326_low_58 (Length: 236)
Name: NF17326_low_58
Description: NF17326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17326_low_58 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 15 - 231
Target Start/End: Complemental strand, 26485078 - 26484862
Alignment:
| Q |
15 |
agatttcaggtaaagatgcagatgccggtgcattaatgttccttcgaaccccaatttccggaggaactatccccatattgtttatcaatccaccacaaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
26485078 |
agatttcaggtaaagatgcagatgccggtgcattaatgttccttcgaaccccaatttccggagggagtatccccatattgtttatcaatccaccacaaca |
26484979 |
T |
|
| Q |
115 |
tgaaacttgttgttgtgctgaattgaattgaagatatgcagggttagacatttccgattgcatcatttgaaaattttgagtaaacacctgtaaagatgaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26484978 |
tgaaacttgttgttgtgctgaattgaattgaagatatgcagggttagacatttccgattgcatcatttgaaaattttgagtaaacacctgtaaagatcaa |
26484879 |
T |
|
| Q |
215 |
ataatttaggagcactt |
231 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
26484878 |
ataatttaggagcactt |
26484862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University