View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17326_low_63 (Length: 214)
Name: NF17326_low_63
Description: NF17326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17326_low_63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 20 - 198
Target Start/End: Complemental strand, 43021087 - 43020909
Alignment:
| Q |
20 |
aatgactagaaatattgtaaattacacaatgtgattggtcacaccactaatgaatatttctgtttcaaggatatgatatgattcggaaagtaataaaaac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43021087 |
aatgactagaaatattgtaaattacacaatgtgattggtcacaccactaatgaatatttctgtttcaaggatatgatatgattcggaaagtaataaaaac |
43020988 |
T |
|
| Q |
120 |
aggaagattgaatttcgattggcaggaaatcgaacatgaaagtaatggcaatggacaggtacccttgaacatcgtgatg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
43020987 |
aggaagattgaatttcgattggcaggaaatcgaacatgaaagtattggcaatggacaggtacccttgaacatcgagatg |
43020909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University