View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17326_low_64 (Length: 213)
Name: NF17326_low_64
Description: NF17326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17326_low_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 11591045 - 11590865
Alignment:
| Q |
18 |
gttgctgcagaaggaaccgaatctcaaacacaaaggaaagagcatgatgatgctgttagagcaaagataatgaagcttaataataaactgaaaaaactga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11591045 |
gttgctgcagaaggaaccgaatctcaaacacaaaggaaagagcatgatgatgctgttagagcaaagataatgaagcttaataataaactgaaaaaactga |
11590946 |
T |
 |
| Q |
118 |
attcatattcttcatttctgaacatcttcaatctcatgtctcttacttggcatctggtttatttggctcaaaatgttcatc |
198 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11590945 |
attcatattcttcttttctgaatatcctcaatctaatgtctcttacttggcatctggtttatttggctcaaaatgttcatc |
11590865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 11646622 - 11646802
Alignment:
| Q |
18 |
gttgctgcagaaggaaccgaatctcaaacacaaaggaaagagcatgatgatgctgttagagcaaagataatgaagcttaataataaactgaaaaaactga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11646622 |
gttgctgcagaaggaaccgaatctcaaacacaaaggaaagagcatgatgatgctgttagagcaaagataatgaagcttaataataaactgaaaaaactga |
11646721 |
T |
 |
| Q |
118 |
attcatattcttcatttctgaacatcttcaatctcatgtctcttacttggcatctggtttatttggctcaaaatgttcatc |
198 |
Q |
| |
|
|||| |||||||| |||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11646722 |
attcgtattcttcttttctgaatatcctcaatctgatgtctcttacttggcatctggtttatttggctcaaaatgttcatc |
11646802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 198
Target Start/End: Original strand, 41833746 - 41833791
Alignment:
| Q |
153 |
atgtctcttacttggcatctggtttatttggctcaaaatgttcatc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41833746 |
atgtctcttacttggcatctggtttatttggctcaaaatgttcatc |
41833791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University