View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17326_low_66 (Length: 205)
Name: NF17326_low_66
Description: NF17326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17326_low_66 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 47368937 - 47368741
Alignment:
| Q |
1 |
ttttgtatggttaagcatgttcacattgcgagacgaaaagagttcaatctattcctttaccctcaaatgcggcgaatcttctcgcttcactcaaagagac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47368937 |
ttttgtatggttaagcatgttcacattgcgagacaaaaagagttcaatctattcctttaccctcaaatgcggcgaatcttctcgattcactcaaagagac |
47368838 |
T |
 |
| Q |
101 |
tggcttaaaatatttgaatttgtgatggaacgaggaatcgagtatcttaacttcgacatgtctggtaaaaattgtcaaatcaaattacccctatgct |
197 |
Q |
| |
|
||| ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
47368837 |
tgggttaaaatttttaaatttgtgatggaacgaggaatcgagtatcttaacttcgacatgtctggtaaaaagtgtcaaatcaaattacctctatgct |
47368741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 125 - 189
Target Start/End: Complemental strand, 7175966 - 7175902
Alignment:
| Q |
125 |
atggaacgaggaatcgagtatcttaacttcgacatgtctggtaaaaattgtcaaatcaaattacc |
189 |
Q |
| |
|
|||||| ||||| ||||| ||||||||||||||||||||||||||||| ||| |||| |||||| |
|
|
| T |
7175966 |
atggaaagaggagtcgagaatcttaacttcgacatgtctggtaaaaatcgtcttatcacattacc |
7175902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 89
Target Start/End: Complemental strand, 38490453 - 38490375
Alignment:
| Q |
11 |
ttaagcatgttcacattgcgagacgaaaagagttcaatctattcctttaccctcaaatgcggcgaatcttctcgcttca |
89 |
Q |
| |
|
|||| ||||||| | |||| ||| |||||| ||||||| |||| |||||| |||||||||| ||||||||||||||| |
|
|
| T |
38490453 |
ttaaccatgttctcgttgctagataaaaagatttcaatccattcttttaccttcaaatgcggtcaatcttctcgcttca |
38490375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University