View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17327_high_6 (Length: 341)
Name: NF17327_high_6
Description: NF17327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17327_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 29 - 288
Target Start/End: Complemental strand, 42978357 - 42978097
Alignment:
| Q |
29 |
acatttgttttcattggtattgaaacgttattaaaggagtccatcagtgttacatgcaacaataccagtgggaacaaaaactccaaccacttaaacatac |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42978357 |
acatttgttttcattggtattgaaacgttattaaaggagtccatcagtgttacatgcaacaataccagtgggaacaaaaactccaaccacttaaacatac |
42978258 |
T |
 |
| Q |
129 |
tagcatataacataatgctgaattccaaagaactgaataaaga--taaatgaacatgtgtaaaaccatctgctatcatacctatgccccgcatgacgaaa |
226 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42978257 |
tagcatata-cataatgctgaattccaaagaactgaataaagagataaatgaacatgtgtaaaaccatctgctatcatacctatgccctgcatgacgaaa |
42978159 |
T |
 |
| Q |
227 |
gaataaaccaggggaagtctctggtactgtaggatcagcagaacctgatgttttaccaacct |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42978158 |
gaataaaccaggggaagtctctggtactgtagtatcagcagaacctgatgttttaccaacct |
42978097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University