View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17328_high_4 (Length: 210)
Name: NF17328_high_4
Description: NF17328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17328_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 21731807 - 21731606
Alignment:
| Q |
1 |
aatcttctcttttactgaaaaccctgattcagttctctataatgcattacttagaaacttgtttatgtttggtgaatatgaaaaaaccannnnnnngtat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||| |||||||| |||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
21731807 |
aatcttctcttttactgaaaaccctgattcaattatctacaatgcattccttagaaatttgtttatgtttggtgaatatgaaaaaaccctttttttgtat |
21731708 |
T |
 |
| Q |
101 |
aaagaaatggttgagaaatctatgtgcccagatgaagattgttgcttatctgttttgaaatctttgttttatgtgtttcatgaaaaagggttgttgatga |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
21731707 |
aaagaaatggttcagaaatctatgtgccctgatgaagattgttgcttttctgttttgaaatctttgttttatgtgtttcatgaaaaagggttgataatga |
21731608 |
T |
 |
| Q |
201 |
tg |
202 |
Q |
| |
|
|| |
|
|
| T |
21731607 |
tg |
21731606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University