View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17329_high_21 (Length: 237)
Name: NF17329_high_21
Description: NF17329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17329_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 22 - 221
Target Start/End: Original strand, 47067538 - 47067737
Alignment:
| Q |
22 |
cagcagtgattctagccttattaaaactttgaatgatgctgacgaggaccagcaagagactggcggaaaccagactatttatcgtgcaacccttgatttt |
121 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47067538 |
cagcagtgattctagccttattaaaattttgaatgatgctgacgaggaccagcaagagactggcggaaaccagactatttatcgtgcaacccttgatttt |
47067637 |
T |
|
| Q |
122 |
gatggggtttttcggctgcatgctcatcatgttaacaatggcagtgacaaaattatcacaagttttccggggaataacccctgtgaagtaaaggggtttt |
221 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47067638 |
gatggggtttttcggctgcatgctcgtcatgttaacaatggcagtgacaaaattatcgcaagttttccggggaataacccctgtgaagtaaaggggtttt |
47067737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 86 - 162
Target Start/End: Complemental strand, 47076725 - 47076649
Alignment:
| Q |
86 |
ggaaaccagactatttatcgtgcaacccttgattttgatggggtttttcggctgcatgctcatcatgttaacaatgg |
162 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||| |||||||||||||||| |
|
|
| T |
47076725 |
ggaaaccagactatttatcgtgcaactcttgattttgatggggtttttaggctgtatgcttatcatgttaacaatgg |
47076649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University