View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17329_low_19 (Length: 245)
Name: NF17329_low_19
Description: NF17329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17329_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 10 - 221
Target Start/End: Complemental strand, 23755293 - 23755080
Alignment:
| Q |
10 |
gcagcacagagcac-aaaacgaagggaaaatgacgactcctgcaa-ttgaatctgacatcaaagtttccctattcttgtgaaaatattgaaaagcaaata |
107 |
Q |
| |
|
||||| |||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23755293 |
gcagcgcagagcaccaaaacaaagggaaaatgacgactcctgcaaattgaatctgacatcaaagtttccctattcttgtgaaaatattgaaaagcaaata |
23755194 |
T |
 |
| Q |
108 |
tatgactcaacagttcaggtacatttttgactaaccataattcacttctagaattttcacctcaagtcatactattactaattagcactcataaattttc |
207 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
23755193 |
tatgactcaacaggtcaggtacacttttgactaaccataattcacttctagaattttcacctcaagtcatactattactaattatcattcataaattttc |
23755094 |
T |
 |
| Q |
208 |
aaatggtgggtctg |
221 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
23755093 |
aaatggtgggtctg |
23755080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University