View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17329_low_21 (Length: 241)
Name: NF17329_low_21
Description: NF17329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17329_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 29252756 - 29252962
Alignment:
| Q |
18 |
atatcatgtcgttctctcctcactttatttactctctgcaagttctttatggtttaatgatccaactctagccttattccagacattgttataatggagt |
117 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29252756 |
atatcatgtcgttctcgac--actttatttactctctgcaagttctttatggtttaatgatccgactctagccttattccagatattgttataatggagt |
29252853 |
T |
 |
| Q |
118 |
tcgaccacattgtagaaataaatttgtagaaagcaaattatcccttattccggtaaataggctttcaatggaaaacgtgggcataaatatagagtgggga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29252854 |
tcgaccacattgtagaaataaatttgtagaaagcaaattatcccttattccggtaaataggctttcaatggaaaacgtgggcataaatatagagtggaga |
29252953 |
T |
 |
| Q |
218 |
acatgcaaa |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
29252954 |
acatgcaaa |
29252962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University