View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17329_low_30 (Length: 205)
Name: NF17329_low_30
Description: NF17329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17329_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 13 - 189
Target Start/End: Complemental strand, 44248866 - 44248690
Alignment:
| Q |
13 |
aaaattaacattaattgaaattgaaattttcaaaacttgttactataattgcttaagataagctgaattttctacccaagatgactgagttgcttccaca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44248866 |
aaaattaacattaattgaaattgaaattttcgaaacttgttactataattgcttaagataagctgaattttctacccaagatgactgagttgcttccaca |
44248767 |
T |
 |
| Q |
113 |
agatactagcaaagatttttgccttcgtcgttggcttagctttaggatcaataattggaaacatctcatccaaaaaa |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44248766 |
agatactagcaaagatttttgccttcgtcgttggcttagctttaggatcaataattggaaacatctcatccaaaaaa |
44248690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University