View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1732R-Insertion-6 (Length: 394)
Name: NF1732R-Insertion-6
Description: NF1732R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1732R-Insertion-6 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 138 - 394
Target Start/End: Original strand, 26672282 - 26672534
Alignment:
| Q |
138 |
ttgaatgtatgaatgagagaggggaactgacatggaagagcgaaacgatcgatggggctggacattgcgatgatgagagaaggaaaccctagctaggaaa |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26672282 |
ttgaatgtatgaatgagagaggggaactgacatggaagagcgaaacgatcgatggggctggacattgcgatgatgagagaaggaaaccctag----gaaa |
26672377 |
T |
|
| Q |
238 |
gaaagaagagaaggcgcgtggaatgagaatggcgcgtgtgtatgaggaaggataataaaaagaagagaagagaatgtagatgggttagggaatcacgaga |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26672378 |
gaaagaagagaaggcgcgtggaatgagaatggcgcgtgtgtatgaggaaggataataaaaagaagagaagagaatgtagatgggttagggaatcacgaga |
26672477 |
T |
|
| Q |
338 |
aaatgatggatgtttagattccttcttccttccgacactgtgttttgttcagctctg |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26672478 |
aaatgatggatgtttagattccttcttccttccgacactgtgttttgttcagctctg |
26672534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 9 - 75
Target Start/End: Original strand, 26672153 - 26672219
Alignment:
| Q |
9 |
caccattactagaactaccagaaatcttaaaatcagattttctttcggttcttttttcatcactacc |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26672153 |
caccattactagaactaccagaaatcttaaaatcagattttctttcggttcttttttcatcactacc |
26672219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University