View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1732_high_11 (Length: 346)
Name: NF1732_high_11
Description: NF1732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1732_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 268; Significance: 1e-149; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 284
Target Start/End: Complemental strand, 10975707 - 10975424
Alignment:
| Q |
1 |
agaaagagattattattgatgttcctcttgcttctagattggtttttagagggttcagttggcctattgctgcttatagagagttgctgaatggtgaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10975707 |
agaaagagattattattgatgttcctcttgcttctagattggtttttagagggttcagttggcctattgctgcttatagagagttggtgaatggtgaact |
10975608 |
T |
 |
| Q |
101 |
cattgccaaggatgtctaagtttcttttgtttacaacaaggttcaactcaaactctcttttaagtttttatttattgtatgaaatttttattattcaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10975607 |
cattgccaaggatgtctaagtttcttttgtttacaacaaggttcaactcaaactctcttttaagtttttatttattgtatgaaatttttattattcaatt |
10975508 |
T |
 |
| Q |
201 |
gctaatttagtcattgagattgagtaaatatccatatattggttaaattatagtattgtacaggtttattcctcacattattga |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |||| |
|
|
| T |
10975507 |
gctaatttagtcattgagattgagtaaatatccatatattggttaaattgtagtattgtacaagtttattcctcacattgttga |
10975424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 271 - 308
Target Start/End: Complemental strand, 33524490 - 33524453
Alignment:
| Q |
271 |
cctcacattattgatatttcaaaattatatatgaaatt |
308 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
33524490 |
cctcacattattgatatttcaaaatgatctatgaaatt |
33524453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 267 - 322
Target Start/End: Original strand, 37445984 - 37446039
Alignment:
| Q |
267 |
tattcctcacattattgatatttcaaaattatatatgaaattgcaatattttaatc |
322 |
Q |
| |
|
|||||||||||||||||||||| |||| ||| |||||||||||| ||||||||| |
|
|
| T |
37445984 |
tattcctcacattattgatattctaaaactatttatgaaattgcataattttaatc |
37446039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University