View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1732_high_2 (Length: 498)
Name: NF1732_high_2
Description: NF1732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1732_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 1e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 94 - 216
Target Start/End: Complemental strand, 25302624 - 25302502
Alignment:
| Q |
94 |
ttcctatattattagtatatatgtcctccataattccagggtgcatgatataaaacggatgattaatacatattggtcgggtggaggtggaaataattga |
193 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||| | ||||||||||||| ||||||||| ||||| |||| |||||||||| ||||||||||| |
|
|
| T |
25302624 |
ttcctatattatgagtatatatgacctccataattccattggtcatgatataaaacagatgattaacacatactggtggggtggaggttgaaataattga |
25302525 |
T |
|
| Q |
194 |
gggattaaatggatgacgtggga |
216 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
25302524 |
gggattaaatggatgacgtggga |
25302502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 25303745 - 25303651
Alignment:
| Q |
1 |
gattactagaaaagagctcaaacatgccctagttcaaatgcaacctgataagtccccaaggtctgatggatttaagcttgtgttctatcattatt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||| | || |||||||||||||| |
|
|
| T |
25303745 |
gattactagaaaagagctcaaacatgccctatttcaaatgcaacctgataagtcctcgaggtctgatggatttaatcctgcgttctatcattatt |
25303651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University