View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1732_high_37 (Length: 236)
Name: NF1732_high_37
Description: NF1732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1732_high_37 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 5834493 - 5834276
Alignment:
| Q |
18 |
ggaaaatactaacataaaaattattaagactttctttagctgctctnnnnnnnnnctttcttttgctatgtcatattttcgctctatgaaactacctaat |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5834493 |
ggaaaatactaacataacaattattaagactttctttaactgctctaaaaaaaa-ctttcttttgctatgtcatattttcgctctatgaaactacctaat |
5834395 |
T |
 |
| Q |
118 |
tcaccagtatagggtttatttttctgaggacttctatgtcatttttcaccaaaatttatttgtactagtttctgctgacatatgattaattatgtattca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5834394 |
tcaccagtatagggtttatttttctgaggacttctatgtcatttttcaccaaaatttatttgtactagtttctgctgacatatgattaattatgtattca |
5834295 |
T |
 |
| Q |
218 |
atataattctagaagttct |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
5834294 |
atataattctagaagttct |
5834276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University