View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1732_high_42 (Length: 222)
Name: NF1732_high_42
Description: NF1732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1732_high_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 17 - 163
Target Start/End: Original strand, 6627323 - 6627469
Alignment:
| Q |
17 |
aatataaccccgtgcactcggagaccgttgaatcggtgcggttgagtattcaatgttagcatcatccacgtgtcgtagcttccttgatcgcgttgatttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6627323 |
aatataaccccgtgcactcggagaccgttgaatcggtgcggttgagtattcaacgttagcatcatccacgtgtcgtagcttccttgatcgcgttgatttt |
6627422 |
T |
 |
| Q |
117 |
ttaccgttgccgaaaaaccacgtgccgcgcgagctcctccttgaatc |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6627423 |
ttaccgttgccgaaaaaccacgtgccgcgcgagctcctccttgaatc |
6627469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University