View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1732_low_23 (Length: 260)
Name: NF1732_low_23
Description: NF1732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1732_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 4 - 244
Target Start/End: Original strand, 1249492 - 1249732
Alignment:
| Q |
4 |
atgtcgaagaatatccaaaaaaggtaactggacaggcagctccactgtcgttgacaatcggtaaacattgctaactgtgtaaccttttccgtagtaagtt |
103 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1249492 |
atgtcgaataagatccaaaaaaggtaactggacagggagctccactgtctttgacaatcggtaaacattgctaactgtgtaaccttttccgtcgtaagtt |
1249591 |
T |
 |
| Q |
104 |
tagtcttttattttcaaaatcggtaaacattgctaactgtataggcatggtttacctatggagtcttccttaaactgtgtgttgtgtgaggggattttgg |
203 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1249592 |
ttgtcttttattttcaaaatcggtaaacattgctaactgtataggcatggtttacctctggagtcttccttaaactgtgtgttgtgtgaggggattttgg |
1249691 |
T |
 |
| Q |
204 |
aaccgacaaaccatttgcttcttcgctgtgtgtttgctaaa |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1249692 |
aaccgacaaaccatttgcttcttcgctgtgtgtttgctaaa |
1249732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University