View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1732_low_29 (Length: 245)
Name: NF1732_low_29
Description: NF1732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1732_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 50663294 - 50663061
Alignment:
| Q |
1 |
tacttctattgatatgttttgttgcagccaaatttacttattttgatactaaaagaaaaacttgtgataaaaaattgattgttggcgctttagttgccaa |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50663294 |
tacttctattgatgtgttttgttgcagccaaatttacttattttgatactaaaagaaaaacttgtgataaaaaattgattgttggagctttagttgccaa |
50663195 |
T |
 |
| Q |
101 |
aataannnnnnnnnn--aaac----tcacagttgttttctttaatgtaaaaaacattgtccatatttattttgattcagatataaaaatgtcagcggtga |
194 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50663194 |
aatatatatatatttttaaacatgctcacagttgttttctttaatgtaaaaaacattgtccatatttattttgattcaga-ataaaaatgtcagcggtga |
50663096 |
T |
 |
| Q |
195 |
atatgtccaccataagacttccgacagcttctttg |
229 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50663095 |
atatgtccaccatgagacttccgacagcttctttg |
50663061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 202
Target Start/End: Complemental strand, 50653478 - 50653432
Alignment:
| Q |
156 |
atatttattttgattcagatataaaaatgtcagcggtgaatatgtcc |
202 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
50653478 |
atatttatttttattcaggtatgaaaatgtcagctgtgaatatgtcc |
50653432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University