View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1732_low_37 (Length: 236)
Name: NF1732_low_37
Description: NF1732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1732_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 45 - 221
Target Start/End: Complemental strand, 38299577 - 38299401
Alignment:
| Q |
45 |
accactgagagaaagccatgcaaatttagaacattccgttgtcctaaataacaaaaacttccaattatgccaattttgtagagagcctaatatggaaact |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38299577 |
accactgagagaaagccatgcaaatttagaacattccgttgtcctaaataacaaaaacttccaattatgccaattttgtagagagcctaatatggaaact |
38299478 |
T |
 |
| Q |
145 |
aacttcaggtgaggccacagatgtagaacataacgctttcttgttataatggtttagggtgatgtaaatgagaatct |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38299477 |
aacttcaggtgaggccacagatgtagaacataacgctttcttgttataatggtttagggtgatgtaaatgagaatct |
38299401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University