View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1732_low_40 (Length: 235)
Name: NF1732_low_40
Description: NF1732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1732_low_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 47769360 - 47769138
Alignment:
| Q |
1 |
aaagtcataaaaatgattatttaatcttaaattaatgcataatagaattttatgctaaccgaatcatcttgaatatgattatctctagtggagggaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47769360 |
aaagtcataaaaatgattatttaatcttaaattagtgcataatagaattttatgctaaccgaatcatcttgaatatgattatctctagtggaggaaactt |
47769261 |
T |
 |
| Q |
101 |
atggaaaaataaagaaaacagcaac--ctcttttatctcttcaaaatgttaggactttgtttagtaacttgtgacagtaatccatgcttaaataaatcag |
198 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47769260 |
atggaaaaataaagaaaacagcaacctctcttttatctcttcaaaatgttaggactttgtttagtaacttgtgacagtaatccatgcttaaataaatcag |
47769161 |
T |
 |
| Q |
199 |
acataccttcaaacatttgtttt |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
47769160 |
acataccttcaaacatttgtttt |
47769138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University