View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1733-Insertion-8 (Length: 403)
Name: NF1733-Insertion-8
Description: NF1733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1733-Insertion-8 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 260 - 401
Target Start/End: Original strand, 3336114 - 3336251
Alignment:
| Q |
260 |
ataggactaggagtagggttagggtttgttaaaaagcagagnnnnnnnnntgtgataacactgcttgaattggggaggaagcaagcaaacgcctttgaca |
359 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3336114 |
ataggactaggagtagagttagggtttgttaaaa-gtagagaaaaaa---tgtgataacactgcttgaattggggaggaagcaagcaaacgtgtttgaca |
3336209 |
T |
|
| Q |
360 |
ggatttggctgtgcagcttgcatttgcattgggacaattttg |
401 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3336210 |
ggatttggctgtgcagcttgcatttggattgggacaattttg |
3336251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 78; Significance: 3e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 310 - 403
Target Start/End: Original strand, 12370058 - 12370151
Alignment:
| Q |
310 |
tgtgataacactgcttgaattggggaggaagcaagcaaacgcctttgacaggatttggctgtgcagcttgcatttgcattgggacaattttgga |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
12370058 |
tgtgataacactgcttgaattggggaggaagcaagcaaacacgtttgacaggatttggctgtacagcttgcatttggattgggacaattttgga |
12370151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 7 - 91
Target Start/End: Original strand, 12369809 - 12369892
Alignment:
| Q |
7 |
aatacggcaatggaaaatggtagggattgggatccaaataattcaacagtagcaatgaaacatatatatgtaactacggctgtaa |
91 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||| |||| |||||||||||||||| |||||||||||||| |
|
|
| T |
12369809 |
aatacggcaagggaaaatggtagggattgg-atccaaataattcaacaatagcgatgaaacatatatatggaactacggctgtaa |
12369892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University