View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1733-Insertion-9 (Length: 131)
Name: NF1733-Insertion-9
Description: NF1733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1733-Insertion-9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 7 - 131
Target Start/End: Complemental strand, 54393154 - 54393030
Alignment:
| Q |
7 |
agttcgaataccgttagacttattgatcagagtcagaatatgattggagtagtatctcttgatcaggcaattcgaacggctgaagatgctgaacttgatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54393154 |
agttcgaataccgttagacttattgatcagagtcagaatatggttggagtagtatctcttgatcaggcaattcgaatggctgaagatgctgaacttgatt |
54393055 |
T |
|
| Q |
107 |
tggtattttcatctttttcttgtta |
131 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
54393054 |
tggtatgttcatctttttcttgtta |
54393030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University