View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17330_high_28 (Length: 236)
Name: NF17330_high_28
Description: NF17330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17330_high_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 80 - 217
Target Start/End: Complemental strand, 4824075 - 4823938
Alignment:
| Q |
80 |
ggtccagaaaacacacttaggaatgtttaagtttcgattcattcaaagactataatgacgctatctcacatatttaaagaccagatgactatttactcac |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4824075 |
ggtccagaaaacacacttaggaatgtttaagtttcgattcattcaaagactataatgacgctatctcacatatttaaggaccagatgactatttactcac |
4823976 |
T |
|
| Q |
180 |
agtttggagtagtatgagcaactgaaggaagtagtaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4823975 |
agtttggagtagtatgagcaactgaaggaagtagtaag |
4823938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 26 - 79
Target Start/End: Complemental strand, 4824416 - 4824363
Alignment:
| Q |
26 |
ttcaatgtaccaattttggagtgtttactcacttctataagtaactgacaggaa |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4824416 |
ttcaatgtaccaattttggagtgtttactcacttctataagaaactgacaggaa |
4824363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University