View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17330_high_30 (Length: 224)
Name: NF17330_high_30
Description: NF17330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17330_high_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 11 - 204
Target Start/End: Original strand, 2382109 - 2382302
Alignment:
| Q |
11 |
gaagaatatggagaagatgaaattctctcggcaggtggagttgtggcagaacatcatgcatcctgttcgtaggttttggatttccattgccacacgtttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2382109 |
gaagaatatggagaagatgaaattctctcggcaggtggagttgtggcagaacatcatgcatcctgttcgtaggttttggatttccattgccacacgtttt |
2382208 |
T |
 |
| Q |
111 |
ggaattcgtaaaactggtaataattcaaaacatgtttggtcctttttctgtatttttggttacatagtacatgtttggttttgatgtttgcaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2382209 |
ggaattcgtaaaactggtaataattcaaaacatgtttggtcctttttctgtatttttggttacatagtacatgtttggttttgatgtttgcaaa |
2382302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University