View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17330_high_6 (Length: 497)
Name: NF17330_high_6
Description: NF17330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17330_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 67 - 320
Target Start/End: Complemental strand, 24932253 - 24932000
Alignment:
| Q |
67 |
aaaaacagataatgatgaccggatggacaagctagccgaaagtcaagaaaattatatcttggatatgtcgagggcacgggaaccctcccacggttagagc |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24932253 |
aaaaacagataatgatgaccggatggacaagctagccgaaagtcaagaaaattatatcttggatatgtcgagggcacgggaaccctcccacggttagagc |
24932154 |
T |
 |
| Q |
167 |
tctaaagatattaatttctgtgtagcacccacacataattgttttgatgtgttccatcttaggaacatagcaggactatatgatattactactgtttgct |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24932153 |
tctaaagatattaatttctgtgtagcacccatacataattgttttgatgtgttccatcttaggaacatagcaggactatatgatattactactgtttgct |
24932054 |
T |
 |
| Q |
267 |
gcaaaaatttccaacgattctagagctagtggtcttgcctgtctctgtaccaat |
320 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24932053 |
gcaaaaatttccaacaattctagagctagtggtcttgcctgtctctgtaacaat |
24932000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 24932427 - 24932365
Alignment:
| Q |
1 |
gttgacaaaggagcaaatcaggatcaaagtgtacaagacataaggacaactttgctgccagta |
63 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24932427 |
gttgacaaagtagcaaatcaggatcaaagtgtacaagacataaggacaactttgctgccagta |
24932365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 359 - 406
Target Start/End: Complemental strand, 24931900 - 24931853
Alignment:
| Q |
359 |
gtaataagatccttatccaaattggtttgtgtttgaagatttcaactt |
406 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| |||||||||||| |
|
|
| T |
24931900 |
gtaataagatccttatacaaattggtttgtctttggagatttcaactt |
24931853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University