View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17330_low_24 (Length: 320)

Name: NF17330_low_24
Description: NF17330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17330_low_24
NF17330_low_24
[»] chr1 (2 HSPs)
chr1 (11-151)||(33742082-33742222)
chr1 (174-305)||(33741916-33742045)


Alignment Details
Target: chr1 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 11 - 151
Target Start/End: Complemental strand, 33742222 - 33742082
Alignment:
11 agaatatgaataagattagagggataattgaaatggggaatgtatggtatctaagtcatagtccgatgggatgggatggtcttttaatttagtccaaggt 110  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
33742222 agaatatgaataagattagagggacaattgaaatggggaatgtatggtatctaagtcataatccgatgggatgggatggtcttttaatttagtccaaggt 33742123  T
111 cgttcaaatattcagactataccatgttgttaatcaaattt 151  Q
    |||||||||||||||||||||||||||||||||||||||||    
33742122 cgttcaaatattcagactataccatgttgttaatcaaattt 33742082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 174 - 305
Target Start/End: Complemental strand, 33742045 - 33741916
Alignment:
174 agaaaaacttagatgtacggtttcaacggaaattaaacattgtggaaaatcactaccaactcaaatgaaaaaagtttattacaactattagnnnnnnnct 273  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |    
33742045 agaaaagcttagatgtacggtttcaacggaaattaaacattgtggaaaatcactaccaactcaaatgaaaaaagtttattacaactattagtttttt--t 33741948  T
274 ttatacaaatattacaactattagttaattgt 305  Q
    || |||||||||||||||||||||||||||||    
33741947 ttttacaaatattacaactattagttaattgt 33741916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University