View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17330_low_29 (Length: 250)
Name: NF17330_low_29
Description: NF17330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17330_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 111 - 244
Target Start/End: Complemental strand, 42956746 - 42956613
Alignment:
| Q |
111 |
ttgaaactaattgcaagcttgtggcagatgccctctctgcccgatatgccacatagcgaattaggggacattatgtcccaatgtaaacgtcacttgatta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42956746 |
ttgaaactaattgcaagcttgtggcagatgccctctctgcccgatatgccacatagcgaattaggggacattatgtcccaatgtaaacgtcacttgatta |
42956647 |
T |
|
| Q |
211 |
ataatcgaaattatgtggtgccatttcatctcac |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
42956646 |
ataatcgaaattatgtggtgccatttcatttcac |
42956613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 42956812 - 42956742
Alignment:
| Q |
1 |
ttatttgggaaataaagctggatgcattaccgagttaccatcacggaagctgaactattggtctccttgaa |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42956812 |
ttatttgggaaataaagctggatgcattaccgagttaccatcacggaagctgaactattggtctccttgaa |
42956742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University