View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17330_low_41 (Length: 219)
Name: NF17330_low_41
Description: NF17330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17330_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 209
Target Start/End: Complemental strand, 25896217 - 25896027
Alignment:
| Q |
19 |
gttgttccatatagacttcctcaacaagaatgccattgagaaaggcattattaatgtccagctgctgaagtggccacttatatgtgagagccaatgtgag |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25896217 |
gttgttccatatagacttcctcatcaagaatgccattgagaaaggcattattaatgtccagctgctgaagtggccacttatatgtgagagccaatgtgag |
25896118 |
T |
 |
| Q |
119 |
gatcaatctgatagtaacagcaggctttatgactggagaaaaagtttcatgataatcaaaaccatgaagtagatgataaccctatgctact |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25896117 |
gatcaatctgatagtaacagcaggctttatgactggagaaaaagtttcatgataatcaaaaccatgaagtagatgataaccctaggctact |
25896027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 21 - 102
Target Start/End: Complemental strand, 39581818 - 39581737
Alignment:
| Q |
21 |
tgttccatatagacttcctcaacaagaatgccattgagaaaggcattattaatgtccagctgctgaagtggccacttatatg |
102 |
Q |
| |
|
|||| |||||| ||||| || |||| |||||||| | ||||||||||||| |||||||| |||||||||||||| |||| |
|
|
| T |
39581818 |
tgttgcatatacacttcttcctcaaggatgccatttaagaaggcattattaacatccagctgttgaagtggccacttgtatg |
39581737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University