View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17330_low_44 (Length: 207)
Name: NF17330_low_44
Description: NF17330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17330_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 19 - 192
Target Start/End: Original strand, 5217623 - 5217796
Alignment:
| Q |
19 |
cctttaacattgtttacctgtatttttccataaaccatgataatgataattgagcaatttatcattnnnnnnnngcttacttttatcttgttttttgacc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
5217623 |
cctttaacattgtttacctgtatttttccataaaccatgataatgataattgagcaatttatcatttaaaaaaagcttacttttatcttgtttttggacc |
5217722 |
T |
 |
| Q |
119 |
tattattatgactaccacattatcatatgatatcagcaaaattttagtggttcggttctgatacaagttctgtg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5217723 |
tattattatgactaccacattatcatatgatatcagcaaaattttagtggttcggttctgatacaagttgtgtg |
5217796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University