View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17331_high_14 (Length: 262)
Name: NF17331_high_14
Description: NF17331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17331_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 44817148 - 44817388
Alignment:
| Q |
1 |
gtgttgctctctatcggaggtggcactggaagctactctctctactcgtcttacgacgcctcacagcttgcaaactacctatggaacaatttcttgggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44817148 |
gtgttgctctctatcggaggtggcactggaagctactctctctactcgtcttacgacgcctcacagcttgcaaactacctatggaacaatttcttgggtg |
44817247 |
T |
 |
| Q |
101 |
gcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaagctggtgatggtcaatattgggatgaacttgcaaaagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44817248 |
gcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaagctggtgatggtcaatattgggatgaacttgcaaaagc |
44817347 |
T |
 |
| Q |
201 |
acttgatgggtttagttcacagaagaaagtttatttgtctg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44817348 |
acttgatgggtttagttcacagaagaaagtttatttgtctg |
44817388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 44834505 - 44834742
Alignment:
| Q |
1 |
gtgttgctctctatcggaggtggcactggaagctactctctctactcgtcttacgacgcctcacagcttgcaaactacctatggaacaatttcttgggtg |
100 |
Q |
| |
|
|||||||| ||| |||||||||| | |||||||||||||| | ||| || | || ||| | ||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
44834505 |
gtgttgctatctctcggaggtggtgccggaagctactctctttcctcagctgatgatgccacgcaggttgcaaattacctatggaacaatttcttgggtg |
44834604 |
T |
 |
| Q |
101 |
gcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaagctggtgatggtcaatattgggatgaacttgcaaaagc |
200 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || || ||| ||||| ||||||| ||| |
|
|
| T |
44834605 |
gcacgtcatcttcaagacctttaggtgatgctgttttggatggaattgattttgatattgaagctggtggtgaacactat---gatgaccttgcaagagc |
44834701 |
T |
 |
| Q |
201 |
acttgatgggtttagttcacagaagaaagtttatttgtctg |
241 |
Q |
| |
|
|||| |||| ||||| ||||| | || |||||| ||||||| |
|
|
| T |
44834702 |
acttaatggttttagctcacaaaggagagtttacttgtctg |
44834742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 80 - 162
Target Start/End: Original strand, 44838060 - 44838142
Alignment:
| Q |
80 |
tatggaacaatttcttgggtggcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaa |
162 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
44838060 |
tatggaacactttcttgggtggcaagtcatcttcaagaccattaggtgatgctgttttagatggaatagattttgatattgaa |
44838142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 80 - 162
Target Start/End: Original strand, 44849147 - 44849229
Alignment:
| Q |
80 |
tatggaacaatttcttgggtggcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaa |
162 |
Q |
| |
|
||||||||| ||||||||||||||| |||| |||||||||||| ||||||||||| || ||||| || |||||||| |||||| |
|
|
| T |
44849147 |
tatggaacactttcttgggtggcacgtcatattcaagaccatttggtgatgctgtgttagatggcatagattttgacattgaa |
44849229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 17571156 - 17570951
Alignment:
| Q |
1 |
gtgttgctctctatcggaggtggcactggaagctactctctctactcgtcttacgacgcctcacagcttgcaaactacctatggaacaatttcttgggtg |
100 |
Q |
| |
|
|||||||||| ||||| ||| ||| |||||||||||||||| |||||||||||||| || | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17571156 |
gtgttgctctttatcgaaggcggcgttggaagctactctctcaactcgtcttacgacaccacgcagcttgcaaactacctatggaacaatttcttgggtg |
17571057 |
T |
 |
| Q |
101 |
gcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaagctggtgatggtcaatattgggatgaacttgcaaaagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
17571056 |
gcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaagctggtgatggtgaacattgggatgaacttgcaaaagc |
17570957 |
T |
 |
| Q |
201 |
acttga |
206 |
Q |
| |
|
|||||| |
|
|
| T |
17570956 |
acttga |
17570951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 150 - 202
Target Start/End: Complemental strand, 23396543 - 23396491
Alignment:
| Q |
150 |
ttttgatattgaagctggtgatggtcaatattgggatgaacttgcaaaagcac |
202 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23396543 |
ttttgatattgaagttggtgatggtcaatattgggatgaacttgcaaaagcac |
23396491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 84 - 174
Target Start/End: Complemental strand, 48222595 - 48222505
Alignment:
| Q |
84 |
gaacaatttcttgggtggcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaagctggtgatggt |
174 |
Q |
| |
|
|||||||||||| || || |||||| ||||||||||||||||||| ||| |||||||| | |||||||| ||||||| ||||| |||| |
|
|
| T |
48222595 |
gaacaatttcttaggagggacatcaaaatcaagaccattaggtgatgttgtgttggatggtgtagattttgacattgaagttggtggtggt |
48222505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 124 - 163
Target Start/End: Original strand, 47980207 - 47980246
Alignment:
| Q |
124 |
ggtgatgctgttttggatggaattgattttgatattgaag |
163 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
47980207 |
ggtgatgctgttttggatggcattgattttgacattgaag |
47980246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 82 - 162
Target Start/End: Original strand, 43901261 - 43901341
Alignment:
| Q |
82 |
tggaacaatttcttgggtggcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaa |
162 |
Q |
| |
|
|||||||| || |||||||| | ||||||||| | ||||| || |||||| | || ||||| |||||||||||||||||| |
|
|
| T |
43901261 |
tggaacaagtttttgggtggaaattcatcttcacgtccatttggcgatgctatattagatggtattgattttgatattgaa |
43901341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University