View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17331_low_16 (Length: 262)

Name: NF17331_low_16
Description: NF17331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17331_low_16
NF17331_low_16
[»] chr1 (4 HSPs)
chr1 (1-241)||(44817148-44817388)
chr1 (1-241)||(44834505-44834742)
chr1 (80-162)||(44838060-44838142)
chr1 (80-162)||(44849147-44849229)
[»] chr3 (1 HSPs)
chr3 (1-206)||(17570951-17571156)
[»] chr4 (1 HSPs)
chr4 (150-202)||(23396491-23396543)
[»] chr7 (2 HSPs)
chr7 (84-174)||(48222505-48222595)
chr7 (124-163)||(47980207-47980246)
[»] chr2 (1 HSPs)
chr2 (82-162)||(43901261-43901341)


Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 44817148 - 44817388
Alignment:
1 gtgttgctctctatcggaggtggcactggaagctactctctctactcgtcttacgacgcctcacagcttgcaaactacctatggaacaatttcttgggtg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44817148 gtgttgctctctatcggaggtggcactggaagctactctctctactcgtcttacgacgcctcacagcttgcaaactacctatggaacaatttcttgggtg 44817247  T
101 gcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaagctggtgatggtcaatattgggatgaacttgcaaaagc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44817248 gcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaagctggtgatggtcaatattgggatgaacttgcaaaagc 44817347  T
201 acttgatgggtttagttcacagaagaaagtttatttgtctg 241  Q
    |||||||||||||||||||||||||||||||||||||||||    
44817348 acttgatgggtttagttcacagaagaaagtttatttgtctg 44817388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 44834505 - 44834742
Alignment:
1 gtgttgctctctatcggaggtggcactggaagctactctctctactcgtcttacgacgcctcacagcttgcaaactacctatggaacaatttcttgggtg 100  Q
    |||||||| ||| ||||||||||  | |||||||||||||| | |||  || | || ||| | ||| ||||||| |||||||||||||||||||||||||    
44834505 gtgttgctatctctcggaggtggtgccggaagctactctctttcctcagctgatgatgccacgcaggttgcaaattacctatggaacaatttcttgggtg 44834604  T
101 gcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaagctggtgatggtcaatattgggatgaacttgcaaaagc 200  Q
    |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||  || |||   ||||| ||||||| |||    
44834605 gcacgtcatcttcaagacctttaggtgatgctgttttggatggaattgattttgatattgaagctggtggtgaacactat---gatgaccttgcaagagc 44834701  T
201 acttgatgggtttagttcacagaagaaagtttatttgtctg 241  Q
    |||| |||| ||||| ||||| | || |||||| |||||||    
44834702 acttaatggttttagctcacaaaggagagtttacttgtctg 44834742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 80 - 162
Target Start/End: Original strand, 44838060 - 44838142
Alignment:
80 tatggaacaatttcttgggtggcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaa 162  Q
    ||||||||| ||||||||||||||  |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||    
44838060 tatggaacactttcttgggtggcaagtcatcttcaagaccattaggtgatgctgttttagatggaatagattttgatattgaa 44838142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 80 - 162
Target Start/End: Original strand, 44849147 - 44849229
Alignment:
80 tatggaacaatttcttgggtggcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaa 162  Q
    ||||||||| ||||||||||||||| |||| |||||||||||| ||||||||||| || ||||| || |||||||| ||||||    
44849147 tatggaacactttcttgggtggcacgtcatattcaagaccatttggtgatgctgtgttagatggcatagattttgacattgaa 44849229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 17571156 - 17570951
Alignment:
1 gtgttgctctctatcggaggtggcactggaagctactctctctactcgtcttacgacgcctcacagcttgcaaactacctatggaacaatttcttgggtg 100  Q
    |||||||||| ||||| ||| |||  |||||||||||||||| |||||||||||||| || | |||||||||||||||||||||||||||||||||||||    
17571156 gtgttgctctttatcgaaggcggcgttggaagctactctctcaactcgtcttacgacaccacgcagcttgcaaactacctatggaacaatttcttgggtg 17571057  T
101 gcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaagctggtgatggtcaatattgggatgaacttgcaaaagc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||    
17571056 gcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaagctggtgatggtgaacattgggatgaacttgcaaaagc 17570957  T
201 acttga 206  Q
    ||||||    
17570956 acttga 17570951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 150 - 202
Target Start/End: Complemental strand, 23396543 - 23396491
Alignment:
150 ttttgatattgaagctggtgatggtcaatattgggatgaacttgcaaaagcac 202  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||    
23396543 ttttgatattgaagttggtgatggtcaatattgggatgaacttgcaaaagcac 23396491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 84 - 174
Target Start/End: Complemental strand, 48222595 - 48222505
Alignment:
84 gaacaatttcttgggtggcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaagctggtgatggt 174  Q
    |||||||||||| || || ||||||   ||||||||||||||||||| ||| ||||||||  | |||||||| ||||||| ||||| ||||    
48222595 gaacaatttcttaggagggacatcaaaatcaagaccattaggtgatgttgtgttggatggtgtagattttgacattgaagttggtggtggt 48222505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 124 - 163
Target Start/End: Original strand, 47980207 - 47980246
Alignment:
124 ggtgatgctgttttggatggaattgattttgatattgaag 163  Q
    |||||||||||||||||||| ||||||||||| |||||||    
47980207 ggtgatgctgttttggatggcattgattttgacattgaag 47980246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 82 - 162
Target Start/End: Original strand, 43901261 - 43901341
Alignment:
82 tggaacaatttcttgggtggcacatcatcttcaagaccattaggtgatgctgttttggatggaattgattttgatattgaa 162  Q
    |||||||| || |||||||| |  ||||||||| | ||||| || |||||| | || ||||| ||||||||||||||||||    
43901261 tggaacaagtttttgggtggaaattcatcttcacgtccatttggcgatgctatattagatggtattgattttgatattgaa 43901341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University