View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17331_low_19 (Length: 250)
Name: NF17331_low_19
Description: NF17331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17331_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 16 - 220
Target Start/End: Complemental strand, 9576734 - 9576527
Alignment:
| Q |
16 |
atactctaccgaaaagatccttcatattctcatcttcaagttgagaataagttacaagctctagaaataaatttcaagctcgattaacaccgtgcgtgtt |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
9576734 |
atactctacctaaaagatccttcatattctcatcttcaagttgagaataagttataagctctagaaataaatttcaagctcgattaacaccatgtgtgtt |
9576635 |
T |
 |
| Q |
116 |
attggatttttcacctaatcataaaggatataagtgttacgagttgtcaagtcgtaaaatatttgtttctataca---tatttttgaagaaaatattttc |
212 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| ||| |||||| |||||||||||||||||||||| |
|
|
| T |
9576634 |
attggatttttcaccaaatcatagaggatataagtgttacgagttgtcaagtcgtaaaatatttatttttatacatattatttttgaagaaaatattttc |
9576535 |
T |
 |
| Q |
213 |
cctttttt |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
9576534 |
cctttttt |
9576527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University