View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17333_high_8 (Length: 314)
Name: NF17333_high_8
Description: NF17333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17333_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 28 - 134
Target Start/End: Original strand, 22390646 - 22390752
Alignment:
| Q |
28 |
tgcaacccattcaatgtggttaaagaattttatctcagctcttggtatagttgattccatttctcagccattgaagatattttgtgataatagctcggct |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22390646 |
tgcaacccattcaatgtggttaaagaattttatctcagctcttggtatagttgattccatttctcggccattgaagatattttgtgataatagctcggct |
22390745 |
T |
|
| Q |
128 |
gtcttct |
134 |
Q |
| |
|
||||||| |
|
|
| T |
22390746 |
gtcttct |
22390752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 162 - 254
Target Start/End: Original strand, 22390748 - 22390840
Alignment:
| Q |
162 |
cttctaaacacataaggattaaattcttagttgttagagaaatggtggaggataatgaaattgaggttgagcacatatccactgaagaaatga |
254 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22390748 |
cttctaaactcgtaaggattaaattcttagttgttagagaaatggtggaggataatgaaattgaggttgagcacatatccaccgaagaaatga |
22390840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 252 - 299
Target Start/End: Original strand, 42256638 - 42256685
Alignment:
| Q |
252 |
tgataggatttttgcttgtcggcattgatcatggttatttgtgatttt |
299 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42256638 |
tgataggttttttgcttgtcggcattgatcatggttatttgtggtttt |
42256685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 252 - 288
Target Start/End: Original strand, 22391413 - 22391449
Alignment:
| Q |
252 |
tgataggatttttgcttgtcggcattgatcatggtta |
288 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22391413 |
tgataggttttttgcttgtcggcattgatcatggtta |
22391449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University