View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17334_low_1 (Length: 253)
Name: NF17334_low_1
Description: NF17334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17334_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 16 - 231
Target Start/End: Complemental strand, 41627737 - 41627521
Alignment:
| Q |
16 |
tattctactcacgaaacctatcggaattcatcttctgataggtgtttttcagcaacatggggg-ccgtagaacaatcgccatctatctatctacattggt |
114 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41627737 |
tattttactcacaaaacctatcggaattcatcttccgataggtgtttttcagcaacatggggggccgtagaacaatccccatctatctatctacattggt |
41627638 |
T |
|
| Q |
115 |
ttgttatgatttcttttaaagaaataccgattggtgcgaagcccaaatcaacgacattcgagatatatgattttgaacatcataagtgagtgataacaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| | |
|
|
| T |
41627637 |
ttgttatgatttcttttaaagaaataccgattggtgcgaagcccaaatcaacgacatttgagacatatgattttgaacatcataagtgagtgataacaga |
41627538 |
T |
|
| Q |
215 |
tataagtgagtaagtga |
231 |
Q |
| |
|
| || |||| ||||||| |
|
|
| T |
41627537 |
tttacgtgaataagtga |
41627521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University