View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17335_high_4 (Length: 318)
Name: NF17335_high_4
Description: NF17335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17335_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 2 - 302
Target Start/End: Original strand, 29932511 - 29932811
Alignment:
| Q |
2 |
tatgagacattatcaaaatacaatactgctagattaacattgaatttcattgatctaatgcttaaatcaaaagtttttatcgaatagctcaactcgataa |
101 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
29932511 |
tatgagacattatcgaaatacaatactgttagatcaacattgaatttcattgatctaatgcttaaatcaaaagtttttatcgaatagctcagctcgacaa |
29932610 |
T |
|
| Q |
102 |
atttgaataaaattactcgatggtctattaaataaattcaaatcaaaatataatataaataagtctatctacaaattttaggttcataagannnnnnnng |
201 |
Q |
| |
|
||||||||||||||||| |||| |||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29932611 |
atttgaataaaattacttgatgctctattgaataaattcaaatcaacatataatataaataagtctatctacaaattttaggttcataagattttttttg |
29932710 |
T |
|
| Q |
202 |
tgtatgatcattaacataaataaattcaacatttataatgaattattaagcagaataactcagttcagatttacttatgcatacattaattttgatacct |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29932711 |
tgtatgatcattaacataaataaattcaacatttataatgaattattaagcagaataactcagttcagatttacttatgcatacattaattttgatacct |
29932810 |
T |
|
| Q |
302 |
c |
302 |
Q |
| |
|
| |
|
|
| T |
29932811 |
c |
29932811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University