View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17335_high_7 (Length: 227)

Name: NF17335_high_7
Description: NF17335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17335_high_7
NF17335_high_7
[»] chr3 (1 HSPs)
chr3 (33-221)||(23531180-23531368)


Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 33 - 221
Target Start/End: Original strand, 23531180 - 23531368
Alignment:
33 atatgctatattctgtatctatgataattatgttcaatccttcagatgacaatgactatgacgattatgaggtggaagacgaggacgaggaggataactt 132  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||    
23531180 atatgctatattctgtatctatgataattatgttcaatccttcagatgacaatgactatgaagattatgaggtggaggacgaggacgaggaggataactt 23531279  T
133 gatcgaaatccaccttccaagcaggaatttgtctaacttaactgaagaatctatgcaaaaattggaagccaggccagatttcatttcag 221  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23531280 gatcgaaatccaccttccaagcaggaacttgtctaacttaactgaagaatctatgcaaaaattggaagccaggccagatttcatttcag 23531368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University