View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17337_high_1 (Length: 408)
Name: NF17337_high_1
Description: NF17337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17337_high_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 10 - 395
Target Start/End: Original strand, 32572144 - 32572529
Alignment:
| Q |
10 |
gcacagaatccgaaatatgtaattgtttcatatgaaggcaaacataatcatggattgcctatgatcacnnnnnnnnntccaacaaactcaagtagtacaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| | |
|
|
| T |
32572144 |
gcacagaatccgaaatatgtaattgtttcatatgaaggcaaacataatcatggattgcctatgatcacaaaaaaaaatccaacaaactcaagtactacca |
32572243 |
T |
|
| Q |
110 |
gcaccacagtagtacgtgggaatgctagcattgtatcaccaccttatgcattgccaatgacccaacctttcacacctcttcaccgctctgaaagttatgg |
209 |
Q |
| |
|
|||| ||||||| |||||||||||||||||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32572244 |
gcacaacagtagcacgtgggaatgctagcatcgtaccaccaccttatgcattggcaatgacccaacctttcacacctcttcaccgctctgaaagttatgg |
32572343 |
T |
|
| Q |
210 |
atcttatggtatgaactgtacttggcctaataataatcctttcttgaacatggtcaacaataccatgatggtgccttatagatatattaatggacaacat |
309 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32572344 |
atcttatggtatgaactgtatttggcctaataataatcctttcttgaacatggtcaacaataccatgatgatgccttatagatatattaatggacaacat |
32572443 |
T |
|
| Q |
310 |
tttcgagatttttatgctgctccttcaattgctgcctctcaagctgttcctagtattggtgaatttcaaatatctccaccgctacc |
395 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32572444 |
tttcgagattgttatgctgctccttcaattgctgcatctcaagctgttcctagtattggtgaatttcaaatatctccaccactacc |
32572529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University